969 resultados para change detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The wide use of antibiotics in aquaculture has led to the emergence of resistant microbial species. It should be avoided/minimized by controlling the amount of drug employed in fish farming. For this purpose, the present work proposes test-strip papers aiming at the detection/semi-quantitative determination of organic drugs by visual comparison of color changes, in a similar analytical procedure to that of pH monitoring by universal pH paper. This is done by establishing suitable chemical changes upon cellulose, attributing the paper the ability to react with the organic drug and to produce a color change. Quantitative data is also enabled by taking a picture and applying a suitable mathematical treatment to the color coordinates given by the HSL system used by windows. As proof of concept, this approach was applied to oxytetracycline (OXY), one of the antibiotics frequently used in aquaculture. A bottom-up modification of paper was established, starting by the reaction of the glucose moieties on the paper with 3-triethoxysilylpropylamine (APTES). The so-formed amine layer allowed binding to a metal ion by coordination chemistry, while the metal ion reacted after with the drug to produce a colored compound. The most suitable metals to carry out such modification were selected by bulk studies, and the several stages of the paper modification were optimized to produce an intense color change against the concentration of the drug. The paper strips were applied to the analysis of spiked environmental water, allowing a quantitative determination for OXY concentrations as low as 30 ng/mL. In general, this work provided a simple, method to screen and discriminate tetracycline drugs, in aquaculture, being a promising tool for local, quick and cheap monitoring of drugs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Wind energy is one of the most promising and fast growing sector of energy production. Wind is ecologically friendly and relatively cheap energy resource available for development in practically all corners of the world (where only the wind blows). Today wind power gained broad development in the Scandinavian countries. Three important challenges concerning sustainable development, i.e. energy security, climate change and energy access make a compelling case for large-scale utilization of wind energy. In Finland, according to the climate and energy strategy, accepted in 2008, the total consumption of electricity generated by means of wind farms by 2020, should reach 6 - 7% of total consumption in the country [1]. The main challenges associated with wind energy production are harsh operational conditions that often accompany the turbine operation in the climatic conditions of the north and poor accessibility for maintenance and service. One of the major problems that require a solution is the icing of turbine structures. Icing reduces the performance of wind turbines, which in the conditions of a long cold period, can significantly affect the reliability of power supply. In order to predict and control power performance, the process of ice accretion has to be carefully tracked. There are two ways to detect icing – directly or indirectly. The first way applies to the special ice detection instruments. The second one is using indirect characteristics of turbine performance. One of such indirect methods for ice detection and power loss estimation has been proposed and used in this paper. The results were compared to the results directly gained from the ice sensors. The data used was measured in Muukko wind farm, southeast Finland during a project 'Wind power in cold climate and complex terrain'. The project was carried out in 9/2013 - 8/2015 with the partners Lappeenranta university of technology, Alstom renovables España S.L., TuuliMuukko, and TuuliSaimaa.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In this work, a colorimetric indicator for food oxidation based on the detection of hexanal in gas-phase, has been developed. In fact, in recent years, the food packaging industry has evolved towards new generation of packaging, like active and intelligent. According to literature (Pangloli P. et al. 2002), hexanal is the main product of a fatty acid oxidation: the linoleic acid. So, it was chosen to analyse two kinds of potato chips, fried in two different oils with high concentration of linoleic acid: olive oil and sunflower oil. Five different formulas were prepared and their colour change when exposed to hexanal in gas phase was evaluated. The formulas evaluations were first conducted on filter paper labels. The next step was to select the thickener to add to the formula, in order to coat a polypropylene film, more appropriate than the filter paper for a production at industrial scale. Three kinds of thickeners were tested: a cellulose derivative, an ethylene vinyl-alcohol and a polyvinyl alcohol. To obtain the final labels with the autoadhesive layer, the polypropylene film with the selected formula and thickener was coat with a water based adhesive. For both filter paper and polypropylene labels, with and without autoadhesive layer, the detection limit and the detection time were measured. For the selected formula on filter paper labels, the stability was evaluated, when conserved on the dark or on the light, in order to determine the storage time. Both potato chips samples, stocked at the same conditions, were analysed using an optimised Headspace-Solid Phase Microextraction-Gas Chromatography-Mass Spectrometry (HS-SPME-GC-MS) method, in order to determine the concentration of volatilized hexanal. With the aim to establish if the hexanal can be considered as an indicator of the end of potato chips shelf life, sensory evaluation was conducted each day of HS-SPME-GC-MS analysis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background and Aim: Acute cardiac rejection is currently diagnosed by endomyocardial biopsy (EMB), but multiparametric cardiac magnetic resonance (CMR) may be a non-invasive alternative by its capacity for myocardial structure and function characterization. Our primary aim was to determine the utility of multiparametric CMR in identifying acute graft rejection in paediatric heart transplant recipients. The second aim was to compare textural features of parametric maps in cases of rejection versus those without rejection. Methods: Fifteen patients were prospectively enrolled for contrast-enhanced CMR followed by EMB and right heart catheterization. Images were acquired on a 1,5 Tesla scanner including T1 mapping (modified Look-Locker inversion recovery sequence – MOLLI) and T2 mapping (modified GraSE sequence). The extracellular volume (ECV) was calculated using pre- and post-gadolinium T1 times of blood and myocardium and the patient’s hematocrit. Markers of graft dysfunction including hemodynamic measurements from echocardiography, catheterization and CMR were collated. Patients were divided into two groups based on degree of rejection at EMB: no rejection with no change in treatment (Group A) and acute rejection requiring new therapy (Group B). Statistical analysis included student’t t test and Pearson correlation. Results: Acute rejection was diagnosed in five patients. Mean T1 values were significantly associated with acute rejection. A monotonic, increasing trend was noted in both mean and peak T1 values, with increasing degree of rejection. ECV was significantly higher in Group B. There was no difference in T2 signal between two groups. Conclusion: Multiparametric CMR serves as a noninvasive screening tool during surveillance encounters and may be used to identify those patients that may be at higher risk of rejection and therefore require further evaluation. Future and multicenter studies are necessary to confirm these results and explore whether multiparametric CMR can decrease the number of surveillance EMBs in paediatric heart transplant recipients.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

From 2010, the Proton Radius has become one of the most interest value to determine. The first proof of not complete understanding of its internal structure was the measurement of the Lamb Shift using the muonic hydrogen, leading to a value 7σ lower. A new road so was open and the Proton Radius Puzzle epoch begun. FAMU Experiment is a project that tries to give an answer to this Puzzle implementing high precision experimental apparatus. The work of this thesis is based on the study, construction and first characterization of a new detection system. Thanks to the previous experiments and simulations, this apparatus is composed by 17 detectors positioned on a semicircular crown with the related electronic circuit. The detectors' characterization is based on the use of a LabView program controlling a digital potentiometer and on other two analog potentiometers, all three used to set the amplitude of each detector to a predefined value, around 1.2 V, set on the oscilloscope by which is possible to observe the signal. This is the requirement in order to have, in the final measurement, a single high peak given by the sum of all the signals coming from the detectors. Each signal has been acquired for almost half of an hour, but the entire circuit has been maintained active for more time to observe its capacity to work for longer periods. The principal results of this thesis are given by the spectra of 12 detectors and the corresponding values of Voltages, FWHM and Resolution. The outcomes of the acquisitions show also another expected behavior: the strong dependence of the detectors from the temperature, demonstrating that an its change causes fluctuations in the signal. In turn, these fluctuations will affect the spectrum, resulting in a shifting of the curve and a lower Resolution. On the other hand, a measurement performed in stable conditions will lead to accordance between the nominal and experimental measurements, as for the detectors 10, 11 and 12 of our system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A-- water bath at 74ºC for 9 h; B-- water bath at 74ºC for 8 h and temperature increased to 100ºC for 1 h; C-- water bath at 74ºC for 2 h and temperature increased to 100ºC for 1 h;; and D-- water bath at 120ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 sec was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A) water bath at 74 ºC for 9 h; B) water bath at 74 ºC for 8 h and temperature increased to 100 ºC for 1 h; C) water bath at 74 ºC for 2 h and temperature increased to 100 ºC for 1 h; and D) water bath at 120 ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37 ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 s was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física