999 resultados para Weber, Eduard Friedrich, 1830-1907
Resumo:
Thesis (doctoral)--Friedrich-Wilhelms-Universitat zu Berlin.
Resumo:
Thesis (doctoral)--Ludwigs-Universität Giessen, 1906.
Resumo:
Thesis (doctoral)--Universitat zu Gottingen.
Resumo:
Thesis (doctoral)--Universitat Leipzig.
Resumo:
Mode of access: Internet.
Resumo:
Mode of access: Internet.
Resumo:
herausgegeben von Dr. Friedrich S. Krauss
Resumo:
Analysis of the word lancea, of Hispanic origin after Varro, and of place names, people´s names and personal names derived from it. It confirms that the spear was the most important weapon in the Bronze Age, belonging to the iuventus and used as heroic and divine symbol. This analysis confirms also the personality of the Lusitanians, a people related to the Celts but with more archaic archaeological, linguistic and cultural characteristics originated in the tradition of the Atlantic Bronze in the II millennium BC. It is also relevant to better know the organisation of Broze and Iron Age societies and the origin of Indo-Europeans peoples in Western Europe and of pre-Roman peoples of Iberia.
Resumo:
Entre los modelos literarios que, en las epopeyas quinientistas acerca de la conquista de México, sirven para dar forma épica a la materia histórica tomada de las crónicas, la Eneida de Virgilio desempeña un papel fundamental. En el presente artículo se pretende mostrar cómo la identificación de Jerónimo de Aguilar con el Aqueménides virgiliano, que se encuentra por primera vez en el Carlo famoso de Luis Zapata, reaparece en Francisco de Terrazas, en Gabriel Lobo Lasso de la Vega y en Antonio de Saavedra Guzmán, así como proponer algunas consideraciones acerca de las relaciones que se hayan podido dar entre las obras de estos poetas.
Resumo:
The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.
Resumo:
Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.
Resumo:
Osler-Weber-Rendu syndrome (OWRS) is a rare hereditary, autosomal dominant disease characterized by a local angiodysplasia. Its clinical characteristics are vascular hamartomas of the skin and oral mucosa, arteriovenous malformations in the lungs, liver, kidney and brain, and episodes of epistaxis. The oral lesions, which become apparent through hemorrhagic telangiectasia, may be the first sign of the disease. This is a case report of a 74-year-old woman whose diagnosis of OWRS was established by her dentist based on the presence of telangiectasia in the skin and oral mucosa, reports of frequent nosebleeds of unknown etiology and a family history of telangiectasia. Amputation of a lower limb and comorbidities, such as cardiopathy, nephropathy and rheumatic disorders, completed the profile. OWRS causes major vascular changes that can be diagnosed initially by a dentist. In this article, we describe the skills and knowledge that dentists need to monitor patients with OWRS properly.
Resumo:
This paper considers the relationship between the recent historiography (of the last quarter century) of “New Zealand architecture” and the historical notion of “New Zealand-ness” invoked in contemporary architecture. It argues that a more recent programmatic uptake of post-War discussions on national identity and regional specificity has fed the tendencies of practicing architects to defer to history in rhetorical defences of their work: the beach-side mansion as a contemporary expression of the 1950s bach; a formal modernism divorced from the social discourse adherent to the historical moment that it “restates”; and so on. The paper will consider instances in the historiography of New Zealand architecture where historians have compounded, consciously or accidentally, a problem that is systemic to the uses made by architects of historical knowledge (in the most general examples), identifying the difficulties of relying upon the tentative conclusions of an under-studied field in developing principles of contemporary architectural practice under the banners of New Zealand-ness, regionalism, or localism, or with reference to icons of New Zealand architectural history. At the heart of this paper is a reflection on historiographical responsibility in presenting knowledge of a national past to an audience that is eager to transform that knowledge into principles of contemporary production. What, the paper asks, is the historical basis for speaking of a New Zealand architecture? Can we speak of a national history of architecture distinct from a regional history, or from an international history of architecture?