999 resultados para Infected peritoneal cavity


Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVES: Evaluate the accuracy of HIV-related oral lesions to predict immune and virologic failure on HIV-infected children in use of highly active antiretroviral therapy (HAART). STUDY DESIGN: Data for this cross-sectional analysis come from a longitudinal study being conducted through the HIV-AIDS Outpatient Unit, ENT Division, Hospital das Clinicas, Sao Paulo University Medical School. The study began in January 1990 and is still ongoing. The cut-off point for analyses purposes was December 2004. Subjects were 471 HIV-infected consecutive children attending the outpatient unit during this period, who enrolled regardless of medical or immunological status. The children have undertaken oral cavity examination, serum CD4(+) T-lymphocyte count, and, 271 of them, viral load measurement. Sensitivity, specificity, positive predictive value, negative predictive value and relative risk were calculated. RESULTS: Oral lesions had moderate sensitivity, high specificity and positive predictive value to predict immune failure. It had low sensitivity and positive predictive value, and high specificity to predict virologic failure. DISCUSSION AND CONCLUSIONS: Oral manifestations of HIV can be important markers for immune suppression and for virologic failure, in Brazilian children undergoing HAART.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

One of the most important immunopathological consequence of intraperitoneal alveolar echinococcosis (AE) in the mouse is suppression of T cell-mediated immune responses. We investigated whether and how intraperitoneal macrophages (MØs) are, respectively, implicated as antigen-presenting cells (APCs). In a first step we showed that peritoneal MØs from infected mice (AE-MØs) exhibited a reduced ability to present a conventional antigen (chicken ovalbumin, C-Ova) to specific responder lymph node T cells. In a subsequent step, AE-MØs as well as naïve MØs (positive control) proved their ability to uptake and process C-Ova fluorescein isthiocyanate (FITC). Furthermore, in comparison with naïve MØs, the surface expression of Ia molecules was up-regulated on AE-MØs at the early stage of infection, suggesting that AE-MØs provide the first signal via the antigen-Ia complex. To study the accessory activity of MØs, AE-MØs obtained at the early and late stages of infection were found to decrease Con A-induced proliferation of peritoneal naïve T cells as well as of AE-sensitized peritoneal T cells, in contrast to stimulation with naïve MØs. The status of accessory molecules was assessed by analysing the expression level of costimulatory molecules on AE-MØs, with naïve MØs as controls. It was found that B7-1 (CD80) and B7-2 (CD86) expression remained unchanged, whereas CD40 was down-regulated and CD54 (= ICAM-1) was slightly up-regulated. In a leucocyte reaction of AE-MØs with naïve or AE-T cells, both types of T cells increased their proliferative response when CD28 - the ligand of B7 receptors - was exposed to anti-CD28 in cultures. Conversely to naïve MØs, pulsing of AE-MØs with agonistic anti-CD40 did not even partially restore their costimulatory activity and failed to increase naïve or AE-T cell proliferation. Neutralizing anti-B7-1, in combination with anti-B7-2, reduced naïve and AE-T cell proliferation, whereas anti-CD40 treatment of naïve MØs increased their proliferative response to Con A. These results point at the key role of B7 receptors as accessory molecules and the necessity of the integrity of CD40-expression by naïve MØs to improve their accessory activity. Taken together, the obstructed presenting-activity of AE-MØs appeared to trigger an unresponsiveness of T cells, contributing to the suppression of their clonal expansion during the chronic phase of AE-infection.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Lautropia mirabilis, a pleomorphic, motile, gram-negative coccus, has been isolated from the oral cavities of 32 of 60 (53.3%) children infected with human immunodeficiency virus (HIV) and 3 of 25 (12.0%) HIV-uninfected controls; the association of L. mirabilis isolation with HIV infection is significant (P < 0.001). All children in the study, both HIV-infected children and controls, were born to HIV-infected mothers. The presence of this bacterium was not associated with clinical disease in these children. The HIV-infected children with L. mirabilis did not differ from the HIV-infected children without L. mirabilis in immunological status, clinical status, or systemic medications. The role of HIV infection itself or concomitant factors in the establishment of L. mirabilis in the oral cavity remains to be elucidated.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Experimental ocean acidification leads to a shift in resource allocation and to an increased [HCO3-] within the perivisceral coelomic fluid (PCF) in the Baltic green sea urchin Strongylocentrotus droebachiensis. We investigated putative mechanisms of this pH compensation reaction by evaluating epithelial barrier function and the magnitude of skeleton (stereom) dissolution. In addition, we measured ossicle growth and skeletal stability. Ussing chamber measurements revealed that the intestine formed a barrier for HCO3- and was selective for cation diffusion. In contrast, the peritoneal epithelium was leaky and only formed a barrier for macromolecules. The ossicles of 6 week high CO2-acclimatised sea urchins revealed minor carbonate dissolution, reduced growth but unchanged stability. On the other hand, spines dissolved more severely and were more fragile following acclimatisation to high CO2. Our results indicate that epithelia lining the PCF space contribute to its acid-base regulation. The intestine prevents HCO3- diffusion and thus buffer leakage. In contrast, the leaky peritoneal epithelium allows buffer generation via carbonate dissolution from the surrounding skeletal ossicles. Long-term extracellular acid-base balance must be mediated by active processes, as sea urchins can maintain relatively high extracellular [HCO3-]. The intestinal epithelia are good candidate tissues for this active net import of HCO3- into the PCF. Spines appear to be more vulnerable to ocean acidification which might significantly impact resistance to predation pressure and thus influence fitness of this keystone species.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objective: The purpose of this study was to grow artificial blood vessels for autologous transplantation as arterial interposition grafts in a large animal model (dog). Method and results: Tubing up to 250 mm long, either bare or wrapped in biodegradable polyglycolic acid (Dexon) or nonbiodegradable polypropylene (Prolene) mesh, was inserted in the peritoneal or pleural cavity of dogs, using minimally invasive techniques, and tethered at one end to the wall with a loose suture. After 3 weeks the tubes and their tissue capsules were harvested, and the inert tubing was discarded. The wall of living tissue was uniformly 1-1.5 mm thick throughout its length, and consisted of multiple layers of myofibroblasts and matrix overlaid with a single layer of mesothelium. The myofibroblasts stained for a-smooth muscle actin, vimentin, and desmin. The bursting strength of tissue tubes with no biodegradable mesh scaffolds was in excess of 2500 mm Hg, and the suture holding strength was 11.5 N, both similar to that in dog carotid and femoral arteries. Eleven tissue tubes were transplanted as interposition grafts into the femoral artery of the same dog in which they were grown, and were harvested after 3 to 6.5 months. Eight remained patent during this time. At harvest, their lumens were lined with endothelium-like cells, and wall cells stained for alpha-actin, smooth muscle myosin, desmin and smoothelin; there was also a thick adventitia containing vasa vasorum. Conclusion: Peritoneal and pleural cavities of large animals can function as bioreactors to grow myofibroblast tubes for use as autologous vascular grafts.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Kaposi's sarcoma (KS) is one of the most frequent neoplastic diseases in patients infected with human immunodeficiency virus (HIV). The authors report the case of a 40-year-old male with ascites, peripheral edema and peritoneal carcinomatosis secondary to a gastric KS related to human herpes virus type 8 (HHV-8). The patient had severe immunodeficiency, with a TCD4+ count of 86 cells/µl and newly diagnosed acquired immunodeficiency syndrome. His clinical condition rapidly deteriorated, with multiorgan failure, and he died without the possibility of initiating antiretroviral therapy or chemotherapy. To the authors’ knowledge, carcinomatosis is a rare feature in KS.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the Amazon Region, there is a virtual absence of severe malaria and few fatal cases of naturally occurring Plasmodium falciparum infections; this presents an intriguing and underexplored area of research. In addition to the rapid access of infected persons to effective treatment, one cause of this phenomenon might be the recognition of cytoadherent variant proteins on the infected red blood cell (IRBC) surface, including the var gene encoded P. falciparum erythrocyte membrane protein 1. In order to establish a link between cytoadherence, IRBC surface antibody recognition and the presence or absence of malaria symptoms, we phenotype-selected four Amazonian P. falciparum isolates and the laboratory strain 3D7 for their cytoadherence to CD36 and ICAM1 expressed on CHO cells. We then mapped the dominantly expressed var transcripts and tested whether antibodies from symptomatic or asymptomatic infections showed a differential recognition of the IRBC surface. As controls, the 3D7 lineages expressing severe disease-associated phenotypes were used. We showed that there was no profound difference between the frequency and intensity of antibody recognition of the IRBC-exposed P. falciparum proteins in symptomatic vs. asymptomatic infections. The 3D7 lineages, which expressed severe malaria-associated phenotypes, were strongly recognised by most, but not all plasmas, meaning that the recognition of these phenotypes is frequent in asymptomatic carriers, but is not necessarily a prerequisite to staying free of symptoms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reports of long-term tenofovir disoproxil fumarate (TDF) treatment in HIV-infected adolescents are limited. We present final results from the open-label (OL) TDF extension following the randomized, placebo (PBO)-controlled, double-blind phase of GS-US-104-0321 (Study 321). HIV-infected 12- to 17-year-olds treated with TDF 300 mg or PBO with an optimized background regimen (OBR) for 24-48 weeks subsequently received OL TDF plus OBR in a single arm study extension. HIV-1 RNA and safety, including bone mineral density (BMD), was assessed in all TDF recipients. Eighty-one subjects received TDF (median duration 96 weeks). No subject died or discontinued OL TDF for safety/tolerability. At week 144, proportions with HIV-1 RNA <50 copies/mL were 30.4% (7 of 23 subjects with baseline HIV-1 RNA >1000 c/mL initially randomized to TDF), 41.7% (5 of 12 subjects with HIV-1 RNA <1000 c/mL who switched PBO to TDF) and 0% (0 of 2 subjects failed randomized PBO plus OBR with HIV-1 RNA >1000 c/mL and switched PBO to TDF). Viral resistance to TDF occurred in 1 subject. At week 144, median decrease in estimated glomerular filtration rate was 38.1 mL/min/1.73 m (n = 25). Increases in median spine (+12.70%, n = 26) and total body less head BMD (+4.32%, n = 26) and height-age adjusted Z-scores (n = 21; +0.457 for spine, +0.152 for total body less head) were observed at week 144. Five of 81 subjects (6%) had persistent >4% BMD decreases from baseline. Some subjects had virologic responses to TDF plus OBR, and TDF resistance was rare. TDF was well tolerated and can be considered for treatment of HIV-infected adolescents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low bone mineral density (BMD) has been found in human immunodeficiency virus (HIV)-infected patients; however, data on associated factors remain unclear, specifically in middle-aged women. This study aims to evaluate factors associated with low BMD in HIV-positive women. In this cross-sectional study, a questionnaire was administered to 206 HIV-positive women aged 40 to 60 years who were receiving outpatient care. Clinical features, laboratory test results, and BMD were assessed. Yates and Pearson χ(2) tests and Poisson multiple regression analysis were performed. The median age of women was 47.7 years; 75% had nadir CD4 T-cell counts higher than 200, and 77.8% had viral loads below the detection limit. There was no association between low BMD at the proximal femur and lumbar spine (L1-L4) and risk factors associated with HIV infection and highly active antiretroviral therapy. Poisson multiple regression analysis showed that the only factor associated with low BMD at the proximal femur and lumbar spine was postmenopause status. Low BMD is present in more than one third of this population sample, in which most women are using highly active antiretroviral therapy and have a well-controlled disease. The main associated factor is related to estrogen deprivation. The present data support periodic BMD assessments in HIV-infected patients and highlight the need to implement comprehensive menopausal care for these women to prevent bone loss.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

From 1992 to 1995 we studied 232 (69% male, 87% Caucasian) anti-human immunodeficiency virus (anti-HIV) positive Brazilian patients, through a questionnaire; HIV had been acquired sexually by 50%, from blood by 32%, sexually and/or from blood by 16.4% and by an unknown route by 1.7%. Intravenous drug use was reported by 29%; it was the most important risk factor for HIV transmission. The alanine aminotransferase quotient (qALT) was >1 for 40% of the patients, 93.6% had anti-hepatitis A virus antibody, 5.3% presented hepatitis B surface antigen, 44% were anti-hepatitis B core antigen positive and 53.8% were anti-hepatitis C virus (anti-HCV) positive. The anti-HCV test showed a significant association with qALT>1. Patients for whom the probable HIV transmission route was blood had a 10.8 times greater risk of being anti-HCV positive than patients infected by other routes. Among 30 patients submitted to liver biopsy, 18 presented chronic hepatitis.