A Microleakage Study Of Gutta-percha/ah Plus And Resilon/real Self-etch Systems After Different Irrigation Protocols.

The development and maintenance of the sealing of the root canal system is the key to the success of root canal treatment. The resin-based adhesive material has the potential to reduce the microleakage of the root canal because of its adhesive properties and penetration into dentinal walls. Moreover, the irrigation protocols may have an influence on the adhesiveness of resin-based sealers to root dentin. The objective of the present study was to evaluate the effect of different irrigant protocols on coronal bacterial microleakage of gutta-percha/AH Plus and Resilon/Real Seal Self-etch systems. One hundred ninety pre-molars were used. The teeth were divided into 18 experimental groups according to the irrigation protocols and filling materials used. The protocols used were: distilled water; sodium hypochlorite (NaOCl)+eDTA; NaOCl+H3PO4; NaOCl+eDTA+chlorhexidine (CHX); NaOCl+H3PO4+CHX; CHX+eDTA; CHX+ H3PO4; CHX+eDTA+CHX and CHX+H3PO4+CHX. Gutta-percha/AH Plus or Resilon/Real Seal Se were used as root-filling materials. The coronal microleakage was evaluated for 90 days against Enterococcus faecalis. Data were statistically analyzed using Kaplan-Meier survival test, Kruskal-Wallis and Mann-Whitney tests. No significant difference was verified in the groups using chlorhexidine or sodium hypochlorite during the chemo-mechanical preparation followed by eDTA or phosphoric acid for smear layer removal. The same results were found for filling materials. However, the statistical analyses revealed that a final flush with 2% chlorhexidine reduced significantly the coronal microleakage. A final flush with 2% chlorhexidine after smear layer removal reduces coronal microleakage of teeth filled with gutta-percha/AH Plus or Resilon/Real Seal SE.

Low-density Three-dimensional Foam Using Self-reinforced Hybrid Two-dimensional Atomic Layers.

Low-density nanostructured foams are often limited in applications due to their low mechanical and thermal stabilities. Here we report an approach of building the structural units of three-dimensional (3D) foams using hybrid two-dimensional (2D) atomic layers made of stacked graphene oxide layers reinforced with conformal hexagonal boron nitride (h-BN) platelets. The ultra-low density (1/400 times density of graphite) 3D porous structures are scalably synthesized using solution processing method. A layered 3D foam structure forms due to presence of h-BN and significant improvements in the mechanical properties are observed for the hybrid foam structures, over a range of temperatures, compared with pristine graphene oxide or reduced graphene oxide foams. It is found that domains of h-BN layers on the graphene oxide framework help to reinforce the 2D structural units, providing the observed improvement in mechanical integrity of the 3D foam structure.

[gait Speed, Grip Strength And Self-rated Health Among The Elderly: Data From The Fibra Campinas Network, São Paulo, Brazil].

The article seeks to investigate patterns of performance and relationships between grip strength, gait speed and self-rated health, and investigate the relationships between them, considering the variables of gender, age and family income. This was conducted in a probabilistic sample of community-dwelling elderly aged 65 and over, members of a population study on frailty. A total of 689 elderly people without cognitive deficit suggestive of dementia underwent tests of gait speed and grip strength. Comparisons between groups were based on low, medium and high speed and strength. Self-related health was assessed using a 5-point scale. The males and the younger elderly individuals scored significantly higher on grip strength and gait speed than the female and oldest did; the richest scored higher than the poorest on grip strength and gait speed; females and men aged over 80 had weaker grip strength and lower gait speed; slow gait speed and low income arose as risk factors for a worse health evaluation. Lower muscular strength affects the self-rated assessment of health because it results in a reduction in functional capacity, especially in the presence of poverty and a lack of compensatory factors.

Self-reported Diabetes In Older People: Comparison Of Prevalences And Control Measures.

The objective of this study was to analyze the prevalence of diabetes in older people and the adopted control measures. Data regarding older diabetic individuals who participated in the Health Surveys conducted in the Municipality of Sao Paulo, SP, ISA-Capital, in 2003 and 2008, which were cross-sectional studies, were analyzed. Prevalences and confidence intervals were compared between 2003 and 2008, according to sociodemographic variables. The combination of the databases was performed when the confidence intervals overlapped. The Chi-square (level of significance of 5%) and the Pearson's Chi-square (Rao-Scott) tests were performed. The variables without overlap between the confidence intervals were not tested. The age of the older adults was 60-69 years. The majority were women, Caucasian, with an income of between > 0.5 and 2.5 times the minimum salary and low levels of schooling. The prevalence of diabetes was 17.6% (95%CI 14.9;20.6) in 2003 and 20.1% (95%CI 17.3;23.1) in 2008, which indicates a growth over this period (p at the limit of significance). The most prevalent measure adopted by the older adults to control diabetes was hypoglycemic agents, followed by diet. Physical activity was not frequent, despite the significant differences observed between 2003 and 2008 results. The use of public health services to control diabetes was significantly higher in older individuals with lower income and lower levels of education. Diabetes is a complex and challenging disease for patients and the health systems. Measures that encourage health promotion practices are necessary because they presented a smaller proportion than the use of hypoglycemic agents. Public health policies should be implemented, and aimed mainly at older individuals with low income and schooling levels. These changes are essential to improve the health condition of older diabetic patients.

Self-etch Adhesive Systems: A Literature Review.

This paper presents the state of the art of self-etch adhesive systems. Four topics are shown in this review and included: the historic of this category of bonding agents, bonding mechanism, characteristics/properties and the formation of acid-base resistant zone at enamel/dentin-adhesive interfaces. Also, advantages regarding etch-and-rinse systems and classifications of self-etch adhesive systems according to the number of steps and acidity are addressed. Finally, issues like the potential durability and clinical importance are discussed. Self-etch adhesive systems are promising materials because they are easy to use, bond chemically to tooth structure and maintain the dentin hydroxyapatite, which is important for the durability of the bonding.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física

Escala de autoaceitação para pessoas com cegueira congênita ou precoce : desenvolvimento e investigação psicométrica = Self-acceptance acale for people with congenital or early blindness : development and psychometric analysis

Universidade Estadual de Campinas . Faculdade de Educação Física

Self-perception and malocclusion and their relation to oral appearance and function

The aim of this study was to evaluate the relationship between malocclusion and self-perception of oral appearance/function, in 12/15-year-old Brazilian adolescents. The cluster sample consisted of 717 teenagers attending 24 urban public (n=611) and 5 rural public (n=107) schools in Maringá/PR. Malocclusion was measured using the Dental Aesthetic Index (DAI), in accordance with WHO recommendations. A parental questionnaire was applied to collect information on esthetic perception level and oral variables related to oral health. Univariate and multiple logistic regression analyses were performed. Multiple logistic regression confirmed that for 12-year-old, missing teeth (OR=2.865) and presence of openbite (open occlusal relationship) (OR=2.865) were risk indicators for speech capability. With regard to 15-year-old, presence of mandibular overjet (horizontal overlap) (OR=4.016) was a risk indicator for speech capability and molar relationship (OR=1.661) was a risk indicator for chewing capability. The impact of malocclusion on adolescents' life was confirmed in this study. Speech and chewing capability were associated with orthodontic deviations, which should be taken into consideration in oral health planning, to identify risk groups and improve community health services.

Morphological analysis of glass, carbon and glass/carbon fiber posts and bonding to self or dual-cured resin luting agents

OBJECTIVE: The aim of this study was to evaluate the morphology of glass (GF), carbon (CF) and glass/carbon (G/CF) fiber posts and their bond strength to self or dual-cured resin luting agents. MATERIAL AND METHODS: Morphological analysis of each post type was conducted under scanning electron microscopy (SEM). Bond strength was evaluated by microtensile test after bisecting the posts and re-bonding the two halves with the luting agents. Data were subjected to two-way ANOVA and Tukey's test (α=0.05). Failure modes were evaluated under optical microscopy and SEM. RESULTS: GF presented wider fibers and higher amount of matrix than CF, and G/CF presented carbon fibers surrounded by glass fibers, and both involved by matrix. For CF and GF, the dual-cured material presented significantly higher (p<0.05) bond strength than the self-cured agent. For the dual agent, CF presented similar bond strength to GF (p>0.05), but higher than that of G/CF (p<0.05). For the self-cured agent, no significant differences (p>0.05) were detected, irrespective of the post type. For GF and G/CF, all failures were considered mixed, while a predominance of adhesive failures was detected for CF. CONCLUSION: The bonding between fiber posts and luting agents was affected by the type of fibers and polymerization mode of the cement. When no surface treatment of the post is performed, the bonding between glass fiber post and dual-cured agent seems to be more reliable.

Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Laços mal-atados como efeito de funcionamento falso-self em tempos de desconfiança

A contemporaneidade contempla formas de estruturação da subjetividade amplamente perpassadas por condições de existência socioculturais e econômicas. Estas, por sua vez, têm promovido laços intersubjetivos frágeis, cujo funcionamento psíquico pode ter uma organização de base "falso-self". Autores também demonstram que diversas instituições atuais se tornaram "fluidas" na passagem da modernidade para a "modernidade líquida". Isto contribuiu para a perda de referências sólidas que, outrora, davam sentido e direcionamento para o ser humano. Em decorrência há uma interferência direta na construção da "confiança madura", visto que os sinais de angústia da contemporaneidade podem ser um desorganizador do funcionamento psíquico, além de promoverem o isolamento, a desconfiança no ambiente e no outro, laços mal-atados e funcionamentos de base "falso-self".

Changes in parents' and self-reports of behavioral problems in Brazilian adolescents after behavioral treatment with urine alarm for nocturnal enuresis

PURPOSE: Compare parents' reports of youth problems (PRYP) with adolescent problems self-reports (APSR) pre/post behavioral treatment of nocturnal enuresis (NE) based on the use of a urine alarm. MATERIALS AND METHODS: Adolescents (N = 19) with mono-symptomatic (primary or secondary) nocturnal enuresis group treatment for 40 weeks. Discharge criterion was established as 8 weeks with consecutive dry nights. PRYP and APSR were scored by the Child Behavior Checklist (CBCL) and Youth Self-Report (YSR). RESULTS: Pre-treatment data: 1) Higher number of clinical cases based on parent report than on self-report for Internalizing Problems (IP) (13/19 vs. 4/19), Externalizing Problems (EP) (7/19 vs. 5/19) and Total Problem (TP) (11/19 vs. 5/19); 2) Mean PRYP scores for IP (60.8) and TP (61) were within the deviant range (T score ≥ 60); while mean PRYP scores for EP (57.4) and mean APSR scores (IP = 52.4, EP = 49.5, TP = 52.4) were within the normal range. Difference between PRYP' and APSR' scores was significant. Post treatment data: 1) Discharge for majority of the participants (16/19); 2) Reduction in the number of clinical cases on parental evaluation: 9/19 adolescents remained within clinical range for IP, 2/19 for EP, and 7/19 for TP. 3) All post-treatment mean scores were within the normal range; the difference between pre and post evaluation scores was significant for PRYP. CONCLUSIONS: The behavioral treatment based on the use of urine alarm is effective for adolescents with mono-symptomatic (primary and secondary) nocturnal enuresis. The study favors the hypothesis that enuresis is a cause, not a consequence, of other behavioral problems.

Self-disclosure of HIV diagnosis to sexual partners by heterosexual and bisexual men: a challenge for HIV/AIDS care and prevention

This study investigated the disclosure of HIV-positive serostatus to sexual partners by heterosexual and bisexual men, selected in centers for HIV/AIDS care. In 250 interviews, we investigated disclosure of serostatus to partners, correlating disclosure to characteristics of relationships. The focus group further explored barriers to maintenance/establishment of partnerships and their association with disclosure and condom use. Fear of rejection led to isolation and distress, thus hindering disclosure to current and new partners. Disclosure requires trust and was more frequent to steady partners, to partners who were HIV-positive themselves, to female partners, and by heterosexuals, occurring less frequently with commercial sex workers. Most interviewees reported consistent condom use. Unprotected sex was more frequent with seropositive partners. Suggestions to enhance comprehensive care for HIV-positive men included stigma management, group activities, and human rights-based approaches involving professional education in care for sexual health, disclosure, and care of "persons living with HIV".

Influence of self-perceived oral health and socioeconomic predictors on the utilization of dental care services by schoolchildren

The influence of socioeconomic factors and self-rated oral health on children's dental health assistance was assessed. This study followed a cross-sectional design, with a multistage random sample of 792 12-year-old schoolchildren from Santa Maria, a city in southern Brazil. A dental examination provided information on the prevalence of dental caries (DMFT index). Data about the use of dental service, socioeconomic status, and self-perceived oral health were collected by means of structured interviews. These associations were assessed using Poisson regression models (prevalence ratio; 95% confidence interval). The prevalence of regular use of dental service was 47.8%. Children from low socioeconomic backgrounds and those who rated their oral health as "poor" used the service less frequently. The distribution of the kind of oral healthcare assistance used (public/private) varied across socioeconomic groups. The better-off children were less likely to have used the public service. Clinical, socioeconomic, and psychosocial factors were strong predictors for the utilization of dental care services by schoolchildren.