402 resultados para Papillomatous Dermatitis
Resumo:
Background. Mycosis Fungoides (MF) is the most common cutaneous T-cell lymphoma, and large cell trasformation (tMF) is an adverse prognostic event. Extra-cutaneous dissemination can occur in the course of the disease, but dissemination to the central nervous system (CNS) is uncommon. Moreover, CNS lymphomas are overall rare and most often of B-cell phenotype. We report a case of CNS large T-cell lymphoma presenting as multiple cerebral lesions in a patient with a history of MF. Methods. We report a case of a 33-year-old woman, known since the age of 16 for erythematous plaques thought to be atopic dermatitis, who developed, end 2012, multiple nodular skin lesions and peripheral adenopathies. Two skin lesions were biopsied simultaneously, and diagnosed as MF and tMF. A lymph node biopsy showed dermatopathic changes without lymphoma (Stage IIB). She received local treatment (UVB, PUVA and radiation therapy) and interferon therapy, and experienced almost complete remission. In 2015 neurological symptoms lead to evidence multiple cerebral lesions, suspicious for lymphoma, evaluated by stereotaxic biopsies. We compared histopathological and molecular features of these with previous skin specimens. After negative bone marrow staging biopsy, she was recently started on chemotherapy (MATRIX). Short follow-up shows rapidly worsening clinical conditions. Results. One of the initial skin biopsies showed atypical lymphoid cells with epidermotropism, Pautrier abcesses and CD4+ CD30- phenotype; the other revealed diffuse dermal infiltration by predominantly large cerebriform tumor cells with high proliferative fraction, and CD2−CD3 −CD4+/−CD7−CD30+ALK- EMA- non-cytotoxic immunophenotype. Altogether, these results led us to diagnose MF and tMF, respectively. The brain was infiltrated by large atypical lymphoid cells with cerebriform nuclei, somewhat anaplastic features and perivascular distribution. By immunohistochemistry, tumor cells were highly proliferative, with a CD2−CD3+CD5−CD7+CD30+ activated cytotoxic immunophenotype. A diagnosis of CD30+ cytotoxic peripheral T-cell lymphoma was retained. TRG and TRB clonality analyses revealed clonal rearrangements in skin and CNS biopsies, with identical patterns in both skin specimens but only minimally overlapping profiles when compared to the CNS sample. Der Pathologe 6 ? 2015 | 633 Conclusions. The reported case illustrates an uncommon finding of a CNS T-cell lymphoma in a patient with previous MF, questioning the clonal relationship between the two diseases and challenging the adequate classification of this CNS lymphoma as either a progression or a de novo lymphoma. Despite differences in immunophenotype and clonality patterns, this CNS lymphoma could possibly represent an aggressive divergent evolution of a primary cutaneous T-cell lymphoma. Additional sequencing is ongoing to try to solve the question.
Resumo:
ABSTRACT Considering the importance of the substrate to bedding in the poultry industry in Brazil, and the enormous pressure on environmental management as to the correct use and management of the waste generated by the production sector, this study aimed to analyze the effect of reuses of two types of litter on sanitary qualities and productive performance of broilers. The study was conducted with litter from 32 different broiler houses, two types of substrates and four cycles of reuses. The litter sanitary quality was verified by the identification of the presence of Escherichia coli and Salmonellaspp. and the incidence of footpad dermatitis. It was observed that the coffee hulls litter presented a reduction of 28.61 percentage points in the probability of occurrence of Salmonella spp when compared to the wood shavings litter, nevertheless, no statistical difference was observed on bacterial occurrence with Salmonella spp. for litter of different types or numbers of reutilization. The presence of Escherichia coli was detected in litter of all cycles, for both types of substrate. The occurrence of footpad lesions was detected for both types of litter, and was influenced by the number of reutilization cycles of the litter. The degree of incidence was detected only for the litter with coffee hull in which there was an increase of 30% between the first and second reuse from which tended to stabilize.
Resumo:
Allergic diseases including food allergy and eczema in an infant in combination with the everyday activities of caring for a family will pose challenges to parents. Only fragments of these challenges are revealed to health care professionals. Families have varying mental, social and economic resources to help them care for an allergic infant, and all such resources are important in determining how families succeed in meeting these challenges and the quality of the infant’s care. This study evaluated the whole burden to the family caused by an infant's allergic disease during the first 24 months of life. As the primary caregiver during this period is usually the mother, her perspective was considered important. Ecocultural theory, which considers families as capable of modifying the positive and negative forces facing them, was taken as the frame of reference. Data were collected as part of an ongoing prospective mother-infant study, and the methods included severity scoring of atopic dermatitis, dietary records, health-related quality of life measurements and assessments of the use of health care services and medications for treating the infant’s eczema, food allergy and asthma. Interviews with mothers were analysed by deductive content analysis on the basis of ecocultural theory and the family empowerment model. The theme “Living an ordinary family life” guided the organization of family activities essential for treating the infant's food allergy and eczema. These activities were sources of both strain and support for the mothers, the allergy-related supporting factors being the mother’s own knowledge of the allergy, hopes for an improvement in the infant’s condition, social support and work. An infant’s food allergy at the age of one year caused considerable strain for the mother in cases where the introduction of new foods into the child’s diet was delayed. This delay was still causing the mother additional strain when the child was 24 months of age. The infants waking at night at the ages of 12 and 24 months because of itching related to eczema caused strain for the mothers. The infants’ health-related quality of life was impaired at ages of 6 and 12 months compared with healthy infants. The principal reasons for impairments were itching, scratching and sleep disturbances at 6 and 12 months and treatment difficulties at 6 months. Problems with getting to sleep were reported at all stages irrespective of eczema and were also present in healthy infants. The economic impact of the treatment of allergic diseases on families during the first 24 months was 131 EUR (2006 value) in cases of eczema and 525 EUR in cases of food allergy. From the societal perspective, the costs of food allergy were a median of 3183 EUR (range 628–11 560 EUR) and of eczema a median of 275 EUR (range 94–1306 EUR). These large variations in costs in food allergy and eczema indicate that disease varies greatly . In conclusion, food allergy and eczema cause extra activities and costs to families which arrange these disease-related activities in such a way that they support the leading family theme “Living an ordinary family life”. Health care professionals should consider this thematic character of family life and disease-related activities in order to ensure that new treatments are sustainable, meaningful and tailored to daily activities. In addition, those mothers who are experiencing difficulties with food allergic infants or infants with eczema should be recognized early and provided with individual encouragement and support from health clinics. In the light of the present results, early detection of symptoms and effective parental guidance can contribute to the well-being and health-related quality of life of the child and family.
Resumo:
Bovine papillomavirus type 8 (BPV-8) was first detected and described in teat warts as well as in healthy teat skin from cattle raised in Japan. The entire viral genome was sequenced in 2007. Additionally, a variant of BPV-8, BPV-8-EB, was also identified from papillomatous lesions of a European bison in Slovakia. In Brazil, despite the relatively common occurrence of BPV infections, the identification and determination of viral types present in cattle is still sporadic. The aim of this study is to report the occurrence of the recently described BPV-8 in Brazil. The virus was identified in a skin warts obtained from a beef cattle herd located in Parana state, southern Brazil. The papilloma had a macular, non-verrucous gross aspect and was located on the dorsal thorax of a cow. Polymerase chain reaction (PCR) was performed using generic primers for partial amplification of L1 gene. The obtained amplicon (480bp) was cloned and two selected clones were sequenced. The nucleotide sequence was compared to existing papillomaviral genomic sequences, identifying the virus as BPV type 8. This study represents the first report of BPV-8 occurrence in Brazil, what suggests its presence among Brazilian cattle.
Resumo:
Different species of Panicum, including P. dichotomiflorum,have been reported as a cause of photosensitization in sheep, horses, cattle and goats. An outbreak of hepatogenous photosensitization occurred in 3 flocks of hair sheep in the Brazilian semiarid region. Eighty one out of 365 sheep were affected and 39 died. The main affected animals were nursing lambs and sheep younger than one year old. Donkeys, goats and cattle grazing in the same pasture were not affected. Clinical signs were edema of the head, followed by dermatitis, mainly in the face, ears, and croup, ocular discharge, corneal opacity with blindness, and redness of the coronary band and hoof. At necropsy of one affected lamb the liver was yellowish. Upon histologic examination scattered necrotic hepatocytes were observed in the liver and focal areas of necrosis of myocytes appeared in the heart. Samples of P. dicotomiflorum were analyzed by TLC and those containing saponins were isolated by HPLC using RP-C18 column and eluted with a mixture of MeOH and H2O. The isolated compounds were submitted to ¹H and 13C NMR spectroscopy. Reactions were positive to furostanol saponins with the same Rf of the standard protodioscin (0.21) and methylprotodioscin (0.32). The spectroscopic results indicated a mixture of (25R)- and (25S)-protodioscin isomers in a proportion of 3:1, and methylprotodioscin.
Resumo:
This paper reports additional information about a mange outbreak by the mite Allopsoroptoides galli in a commercial egg-laying hen facility in the state of São Paulo, Brazil. About half of the 76,000 multi-age birds of the flock were affected. Experimental infestations carried out on naive hens resulted in clinical signs similar to those diagnosed in naturally infested hens, such as generalized scaly dermatitis, presence of mucus-like material and yellowish crusts on the skin and around the calami, feather loss and strong unpleasant odor. About 30% drop of egg production was estimated. The possible source of infestation were wild birds identified on the ground and roofs of the sheds.
Resumo:
Pemphigus is an inflammatory autoimmune disorder of the skin. Nitric oxide (NO) is an inflammatory mediator linked to a variety of physiological and pathophysiological phenomena that include skin tumors, psoriasis, urticaria, and atopic dermatitis. Inflammatory cells present in pemphigus lesions are important sources of NO production. We investigated whether NO is involved in pemphigus. A prospective cohort study was conducted at the Dermatology Service of the Hospital Universitário Walter Cantídio of the Federal University of Ceará. All patients seen at the outpatient clinic between August 2000 and July 2001, with a clinically and histologically confirmed diagnosis of pemphigus were included. The median age was 42.5 years (range: 12-69 years) with a male to female ratio of 3:2. Total serum nitrite levels, used as a marker for NO production, were determined by the Griess reaction. Skin biopsies from pemphigus and breast surgery (control) patients were used for the detection of the inducible NO synthase (iNOS) by immunohistochemistry. Twenty-two (22) patients with pemphigus and eight (8) controls who did not differ in demographic characteristics were included. Total serum nitrite levels were significantly higher (>7 µmol/L) in pemphigus patients compared to controls (<6 µmol/L), regardless of the severity of the clinical activity of pemphigus (P < 0.0001). All pemphigus biopsies presented increased immunostaining for iNOS that was not detected in normal skin samples. These data are the first to demonstrate that pemphigus patients display increased serum NO levels that are associated with increased iNOS expression in the affected skin.
Resumo:
Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
L’approche Module X a été créée dans le but de concevoir de petits peptides modulateurs ayant des propriétés allostériques. Module X reproduit de petites parties des portions extracellulaires flexibles des récepteurs. Ces petits peptides vont interagir en s’interposant entre deux sous unités ou entre deux régions de la même sous-unité qui interagissent par des liens hydrogènes, des ponts salins ou des liens disulfure. Ces régions sont spécialement choisies à l’extérieur du domaine de liaison du ligand orthostérique et sont situées dans les régions inter domaines, la portion juxta membranaire ou dans les boucles. Étant donné que les boucles sont exposées durant les changements de conformation, une séquence peptidique reproduisant certaines régions de ces boucles pourrait s’insérer à un endroit approprié dans la structure où se lier à son partenaire de signalisation dans le complexe protéique, ce qui aurait comme effet de déplacer l’équilibre de l’ensemble vers un état particulier et modulerait ainsi la signalisation. De cette façon, certaines voies de signalisation pourraient être partiellement inhibées tandis que d’autres voies ne seraient pas touchées puisque le ligand orthostérique pourrait toujours se lier au récepteur. Dans une première étude, nous avons conçu des peptides inhibiteurs du récepteur de l’interleukine 1 (IL-1R/IL-1RAcP) plus précisément en reproduisant des régions flexibles de la protéine accessoire, sous-unité signalisatrice du récepteur. IL-1 est un médiateur majeur de l’inflammation, mais le seul antagoniste disponible est l’analogue naturel de IL-1, IL-1Ra qui compétitionne avec IL-1 pour le site de liaison sur le récepteur. Nous avons conçu plusieurs peptides à partir des boucles de la protéine accessoire. Un de ces peptides, rytvela (101.10) a démontré des propriétés de non-compétitivité et de sélectivité fonctionnelle caractéristiques des modulateurs allostériques. 101.10 bloque la prolifération des thymocytes et la synthèse de PGE2 avec un IC50 de 1 nM mais une efficacité de 100 % et 45 % respectivement et ne déplace pas IL-1 radioactif dans des essais de radioliaisons. De plus, 101.10 n’a qu’un effet minime sur l’affinité de IL-1 pour son récepteur. 101.10 démontre, de plus, une activité inhibitrice in vivo dans des modèles d’inflammation de l’intestin chez le rat (efficacité supérieure aux corticostéroïdes et à IL-1Ra) et de dermatite chez la souris de même que dans un modèle d’hyperthermie induite par IL-1. La deuxième étude démontre que Module X peut être utilisé pour concevoir des inhibiteurs pour une autre grande famille de récepteurs : les récepteurs couplés aux protéines G. La vasopressine joue un rôle important dans l’équilibre hydro-osmotique et un moindre rôle dans la vasomotricité. Six peptides ont été conçus à partir de régions juxta membranaires du récepteur de la vasopressine V2R. Le peptide le plus actif, VRQ397 (IC50 = 0,69 nM dans un modèle de vasorelaxation du crémastère), a démontré de la sélectivité fonctionnelle en inhibant la synthèse de prostacycline mais sans inhiber l’activation de la protéine Gs et la génération d’ AMP cyclique. Le peptide VRQ397 ne pouvait déplacer le ligand naturel AVP marqué radioactivement; de même VRQ397 radioactif ne se liait que sur V2R et non pas sur d’autres récepteurs de la même famille tel que V1R (récepteur de la vasopressine de type I). Ces études décrivent la caractérisation de petits peptides modulateurs de la signalisation de IL-1R et V2R et présentant des propriétés de modulateurs allostériques.
Resumo:
Begleitpersonen in der stationären Kinderrehabilitation: Bedarf für psychologische Interventionen und Evaluation eines Betreuungsmodells (am Beispiel „Triple-P-Programm”) Chronisch erkrankte Kinder im Vorschulalter, die eine stationäre Reha-Maßnahme absolvieren, werden üblicherweise von einer Bezugsperson (Elternteil oder nahe Verwandte) begleitet. Da diese sog. Begleitpersonen normalerweise nicht krank sind, sind psychologische Interventionen nicht vorgesehen. Dennoch hebt der VDR in seinem Rahmenkonzept hervor, dass Eltern sowohl über die Behandlung der Erkrankung ihres Kindes als auch über konsequente Erziehung informiert werden sollten. Diese Studie untersucht, ob psychologische Interventionen für Begleitpersonen sinnvoll und effektiv sind. Sie wurde in der Fachklinik Satteldüne der DRV Nord durchgeführt. Die Kinder, die in dieser Einrichtung behandelt werden, leiden an chronischen Erkrankungen wie Asthma, atopischer Dermatitis, Allergien und Infektanfälligkeit. 134 Begleitpersonen (127 Mütter und 7 Väter) nahmen an einer quasiexperimentellen Feldstudie teil. Zu Beginn der Reha-Maßnahme (t1) füllten sie Fragebögen zu ihrer psychischen Belastung und ihrem Erziehungsverhalten sowie zu Problemverhalten ihrer Kinder aus. Vier Wochen später zum Ende der Reha-Maßnahme (t2) beurteilten die Begleitpersonen und das Reha-Team den Reha-Erfolg der Kinder. Zu t1 zeigte diese Stichprobe ein überdurchschnittliches Ausmaß an psychischer Belastung, welches bei einem Drittel der Befragten ein klinisch relevantes Ausmaß erreichte. Die psychische Belastung zu t1 korrelierte negativ mit dem Reha-Erfolg der Kinder zum Ende der Behandlung (in der Einschätzung durch Begleitpersonen und Stationsärzte). Dysfunktionales Erziehungsverhalten zeigten 20 % der Begleitpersonen. Dieses korrelierte negativ mit dem Reha-Erfolg der Kinder (in der Einschätzung durch das Pflegepersonal). Es wurden positive Korrelationen zwischen dysfunktionalem Erziehungsverhalten sowie psychischer Belastung der Begleitpersonen und Verhaltensauffälligkeiten der Kinder gefunden. Das Ausmaß der Verhaltensauffälligkeiten lag bei Kleinkindern (bis drei Jahre, n=29) im durchschnittlichen – und bei Vorschulkindern (4-7 Jahre, n=94) im überdurchschnittlichen Bereich. Es zeigte sich ein starkes Interesse der Befragten, während der Reha-Maßnahme an psychologischen Interventionen teilzunehmen. Für das Entspannungstraining interessierte sich jede zweite Begleitperson und ein Drittel der Befragten hatte Interesse die Erziehungsberatung wahrzunehmen. Dennoch nahm nur ein geringer Anteil der anfänglich Interessierten tatsächlich an diesen Interventionen teil (Entspannungstraining: 23 %, Erziehungsberatung: 16 %, psychologische Einzelgespräche: 11,4 %). Es fanden sich signifikante positive Korrelationen zwischen der Zufriedenheit der Begleitpersonen mit der Reha-Maßnahme und a) dem Ausmaß der Erfüllung der Erwartungen der Begleitperson an die Reha-Maßnahme und b) dem Reha-Erfolg des Kindes (eingeschätzt durch die Begleitperson). Zudem zeigten Begleitpersonen, deren psychische Belastung während der Reha-Maßnahme anstieg, eine geringere Zufriedenheit mit der Reha-Maßnahme als diejenigen, deren psychische Belastung sich verringerte. Darüber hinaus wurden die Effekte von verschiedenen psychologischen Betreuungsmodellen für Begleitpersonen untersucht. In einer quasiexperimentellen Studie wurden 64 Begleitpersonen (63 Mütter, 1 Vater) auf zwei Gruppen aufgeteilt. Beide Gruppen konnten auf freiwilliger Basis am Psychologischen Standardprogramm für Begleitpersonen teilnehmen (Erziehungsberatung, psychologische Einzelgespräche, Entspannungstraining). Die 32 Begleitpersonen der EG nahmen zusätzlich an einer Triple-P-Gruppenintervention teil. Zu Beginn (t1) und zum Ende der vierwöchigen Behandlung (t2) sowie sechs Monate nach der Reha-Maßnahme (t3) wurden die Merkmale psychische Belastung und Erziehungsverhalten der Begleitpersonen sowie Problemverhalten der Kinder erhoben. An der Intervention Triple-P nahmen 64 % der Begleitpersonen teil; am Psychologischen Standardprogramm nur 22,7 %. Die Ergebnisse zu t2 zeigen positive Effekte der Behandlung: beide Gruppen verbesserten ihr Erziehungsverhalten, die psychische Belastung der Begleitpersonen und Verhaltensauffälligkeiten der Kinder verringerten sich. Die Verbesserung des Erziehungsverhaltens fiel zu t2 bei der EG signifikant stärker aus als bei der KG. Die Effekte auf das Erziehungsverhalten der Eltern und auf Verhaltensauffälligkeiten der Kinder hielten ein halbes Jahr an, da sie zu t3 erneut vorgefunden wurden. Ein nachhaltiger Effekt auf die psychische Belastung der Begleitpersonen lag nicht vor. Zu t3 wurden keine signifikanten Unterschiede zwischen EG und KG gefunden. Zusammenfassend betrachtet zeigt diese Studie, dass der Bedarf für psychologische Interventionen für Begleitpersonen in der stationären Kinderrehabilitation gerechtfertigt ist und eine Reduktion von psychischer Belastung und dysfunktionalem Erziehungsverhalten der Begleitperson den Reha-Erfolg des Kindes erhöhen kann. In Zukunft sind weitere Anstrengungen nötig, um die psychische Belastung von Begleitpersonen zu verringern, z.B. über eine stärkere Verpflichtung zur Teilnahme an den psychologischen Interventionen, eine bessere Verzahnung von ambulanten und stationären Interventionen und die kontinuierliche Evaluation von neuen psychologischen Interventionen.
Resumo:
El thinner es uno de los productos de mayor utilización en la industria de las pinturas, lubricantes y pegamentos. Su composición es variable de acuerdo con su uso y calidad. Sin embargo, la exposición crónica es una preocupación debido a que puede afectar órganos principales tales como pulmones, hígado, riñón y glándulas suprarrenales. En este estudio fue caracterizada la composición de varias muestras de thinner, disponibles comercialmente en la ciudad de Cartagena, que fueron recolectadas en diferentes almacenes y analizadas por cromatografía de gases acoplada a espectrometría de masas (GC/MS). Los resultados mostraron que no solo la composición, sino también la distribución relativa de los componentes presentes en las muestras son variables. Treinta y dos compuestos fueron detectados, entre los que se encuentran: tolueno, o-xileno, pxileno y etilbenceno, con frecuencias de aparición de 91,7, 66,7, 75,0 y 66,7 %, respectivamente. El desconocimiento del riesgo de intoxicación, generado al manipular este tipo de mezclas, puede ser la causa de muchos de los problemas de salud en personas expuestas al thinner, tanto en actividades laborales como domésticas. Una minería de datos mostró la asociación potencial entre los componentes del thinner y manifestaciones clínicas, las cuales incluyen daño renal y hepático, pérdida de cabello, alteraciones hematológicas, dermatitis, ansiedad y problemas de equilibrio, entre otras. En conclusión, el thinner posee gran variabilidad tanto en sus componentes como en la proporción relativa de los mismos. Los efectos perjudiciales en la salud por exposición directa o indirecta a estos componentes han sido ampliamente descritos en la literatura
Resumo:
Este estudio buscó evaluar la asociación de desórdenes músculo esqueléticos en región cervical, dorsal y lumbar identificados mediante el Cuestionario Nórdico en su versión validada al español y los factores de riesgo psicosocial con el Cuestionario del contenido del trabajo (JCQ), en conductores de vehículos de carga de una empresa de transporte terrestre en Bogotá, Colombia; fue un estudio de corte transversal con la participación voluntaria de 125 conductores. Los resultados demostraron mayor prevalencia de trastornos músculo esqueléticos en región lumbar en los últimos 12 meses en el 36% de los participantes y en los últimos tres meses en región cervical con el 17.6%; la prevalencia de factores psicosociales arrojó trabajo de baja tensión en el 29.6%, trabajo activo 26.4%, trabajo con alta tensión 23.2% y trabajo pasivo con el 20.8%. El valor p fue mayor de 0,005 no hallándose asociaciones significativas de desórdenes músculo esqueléticos en región cervical, dorsal y lumbar con factores de riesgo psicosocial.
Resumo:
Las actividades de mantenimiento automotriz en el sector de autopartes conlleva el uso de agentes químicos bajo diversas circunstancias de exposición, tanto en las condiciones de manipulación de productos químicos como a las características propias de cada actividad de mantenimiento asociado a las tareas específicas del trabajo. Tradicionalmente la evaluación de contaminantes químicos desde la visión de la Higiene Ocupacional incluye la evaluación cuantitativa de la exposición mediante técnicas instrumentales concretas y estandarizadas, determinando el nivel de concentración en aire a la cual un trabajador se ve expuesto y que, en comparación con valores límites permisibles (VLPs), inducen el establecimiento de medidas de control y vigilancia, según el nivel de riesgo caracterizado. Sin embargo es evidente la limitación de la implementación de esta sistemática en particular en micros y pequeñas empresas que carecen de los recursos suficientes para abordar la problemática de forma objetiva. En este contexto diversas metodologías de evaluación cualitativa o subjetiva se han desarrollado por distintas organizaciones en el mundo con el fin de disminuir la brecha entre el establecimiento de medidas de control y la valoración del riesgo, ofreciendo alternativas confiables para la toma de decisiones preventivas sin la necesidad de acudir a mediciones cuantitativas. Mediante la presente investigación se pretende validar la efectividad en el uso de una herramienta de evaluación simplificada del riesgo químico propuesta por el INRS (Institut National de Recherche et de Sécurité Francés) mediante la determinación del perfil de exposición potencial a contaminantes químicos de la población laboral de 36 almacenes de autopartes ubicados en el barrio la Paz de la ciudad de Bogotá, Colombia, divididos según énfasis de actividades en Partes Externas, Partes Eléctricas e Inyección, Partes Mecánicas, Partes Múltiples, a través de un estudio de corte transversal. El estudio permitió Jerarquizar el riesgo potencial, valorar el riesgo vía inhalatoria y dérmica para finalmente construir el perfil de exposición potencial a contaminantes químicos de trabajadores. La información de las variables de análisis fue consolidada en una herramienta informática diseñada para tal fin, la cual facilito la administración de los datos y su respectivo análisis. Con base en los hallazgos fue posible establecer los productos químicos que de acuerdo a las condiciones de trabajo y circunstancias de exposición sugieren medidas específicas para la disminución del riesgo potencial de acuerdo a la calificación global de los agentes, permitiendo deducir la viabilidad de la aplicación de herramientas de valoración cualitativa para la evaluación del riesgo químico como estrategia de prevención primaria.
Resumo:
Introducción Dentro de los factores más comunes que influyen en la causa de accidentes o enfermedades laborales están el de riesgo biomecánico los cuales pueden desencadenar trastornos musculo esqueléticos generados por la repetición excesiva de movimientos, posturas forzadas y levantar objetos pesados. Otros posibles factores de riesgo son de origen físico, psicológico o personal. Estos factores pueden relacionarse entre sí y su influencia también puede estar mediada por factores culturales o sociales. Objetivo Determinar las condiciones laborales, de salud y seguridad en el trabajo de la población asistencial y administrativa de una IPS en la ciudad de Yopal Casanare. Método Se realizó un estudio de corte transversal en 88 trabajadores del equipo de salud tanto asistencial y administrativo de I y II nivel de complejidad. Se aplicó el instrumento Cuestionario Nórdico de seguridad y el de condiciones de trabajo y salud. Resultados En este estudio se encontró una participación mayor del género femenino con un 88,6%. La percepción de la estabilidad laboral fue alta en un 60,2%, media en un 37,5% y baja en el 2,3% de los trabajadores. En cuanto a la posición habitual de trabajo, se encontró que el 41% de los trabajadores del nivel asistencial debe trabajar de pie mientras que en los niveles administrativo y directivo la posición de trabajo habitual es sentada, con un 51,9% y un 66,7% respectivamente. Respecto a la realización de movimientos repetitivos se presentan en el nivel asistencial con un 34,5% y en el nivel directivo con un 50%. En las condiciones de salud, predomina el dolor en los miembros superiores e inferiores siendo el más reportado el dolor de muñeca tanto en el área administrativa como en la asistencial. En la percepción de seguridad frente al trabajo, se encontró que el 38% consideran los accidentes menores como parte normal del trabajo diario, en el nivel administrativo el 74% acepta correr riesgos incluso cuando los tiempos de trabajo son ajustados. Conclusión Las condiciones de seguridad y salud de los trabajadores evaluados se caracterizaron por sobre carga laboral, autonomía en el trabajo y la concientización de la importancia de la seguridad en el área de trabajo. Un lugar de trabajo que los empleados toleran y disfrutan puede fomentar la motivación laboral y ofrecer mejores resultados. Sin embargo, las malas condiciones en el lugar de trabajo, pueden afectar el rendimiento y la productividad de los empleados.