A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Poly(beta-hydroxybutyrate-co-beta-hydroxyvalerate) supports in vitro osteogenesis

Studies have demonstrated that polymeric biomaterials have the potential to support osteoblast growth and development for bone tissue repair. Poly( beta- hydroxybutyrate- co- beta- hydroxyvalerate) ( PHBV), a bioabsorbable, biocompatible polyhydroxy acid polymer, is an excellent candidate that, as yet, has not been extensively investigated for this purpose. As such, we examined the attachment characteristics, self- renewal capacity, and osteogenic potential of osteoblast- like cells ( MC3T3- E1 S14) when cultured on PHBV films compared with tissue culture polystyrene ( TCP). Cells were assayed over 2 weeks and examined for changes in morphology, attachment, number and proliferation status, alkaline phosphatase ( ALP) activity, calcium accumulation, nodule formation, and the expression of osteogenic genes. We found that these spindle- shaped MC3T3- E1 S14 cells made cell - cell and cell - substrate contact. Time- dependent cell attachment was shown to be accelerated on PHBV compared with collagen and laminin, but delayed compared with TCP and fibronectin. Cell number and the expression of ALP, osteopontin, and pro- collagen alpha 1( I) mRNA were comparable for cells grown on PHBV and TCP, with all these markers increasing over time. This demonstrates the ability of PHBV to support osteoblast cell function. However, a lag was observed for cells on PHBV in comparison with those on TCP for proliferation, ALP activity, and cbfa- 1 mRNA expression. In addition, we observed a reduction in total calcium accumulation, nodule formation, and osteocalcin mRNA expression. It is possible that this cellular response is a consequence of the contrasting surface properties of PHBV and TCP. The PHBV substrate used was rougher and more hydrophobic than TCP. Although further substrate analysis is required, we conclude that this polymer is a suitable candidate for the continued development as a biomaterial for bone tissue engineering.

In vitro bioactivity of titanium-doped bioglass

Previous studies have suggested that incorporating relatively small quantities of titanium dioxide into bioactive glasses may result in an increase in bioactivity and hydroxyapatite formation. The present work therefore investigated the in vitro bioactivity of a titanium doped bioglass and compared the results with 45S5 bioglass. Apatite formation was evaluated for bioglass and Ti-bioglass in the presence and absence of foetal calf serum. Scanning electron microscopy (SEM) images were used to evaluate the surface development and energy dispersive X-ray measurements provided information on the elemental ratios. X-ray diffraction spectra confirmed the presence of apatite formation. Cell viability was assessed for bone marrow stromal cells under direct and indirect contact conditions and cell adhesion was assessed using SEM. © 2014 Springer Science+Business Media.

Lung on a chip: Co-culture of alveolar epithelial cells and bone marrow derived stromal stem cells in a microfluidic system

Background: Microfluidics system are novel tools to study cell-cell interactions in vitro. This project focuses on the development of a new microfluidic device to co-culture alveolar epithelial cells and mesenchymal stem cells to study cellular interactions involved in healing the injured alveolar epithelium. Methods: Microfluidic systems in polydimethylsiloxane were fabricated by soft lithography. The alveolar A549 epithelial cells were seeded and injury tests were made on the cells by perfusion with media containing H2O2 or bleomycin during 6 or 18hrs. Rat Bone marrow derived stromal cells (BMSC) were then introduced into the system and cell-cell interaction was studied over 24 hrs. Results: A successful co-culture of A549 alveolar epithelial cells and BMS was achieved in the microfluidic system. The seeded alveolar epithelial cells and BMSC adhered to the bottom surface of the microfluidic device and proliferated under constant perfusion. Epithelial injury to mimic mechanisms seen in idiopathic pulmonary fibrosis was induced in the microchannels by perfusing with H2O2 or bleomycin. Migration of BMSC towards the injured epithelium was observed as well as cell-cell interaction between the two cell types was also seen. Conclusion: We demonstrate a novel microfluidic device aimed at showing interactions between different cell types on the basis of a changing microenvironment. Also we were able to confirm interaction between injured alvolar epithelium and BMSC, and showed that BMSC try to heal the injured epitelium.

Diet-induced obesity alters the differentiation potential of stem cells isolated from bone marrow, adipose tissue and infrapatellar fat pad: the effects of free fatty acids.

INTRODUCTION: Obesity is a major risk factor for several musculoskeletal conditions that are characterized by an imbalance of tissue remodeling. Adult stem cells are closely associated with the remodeling and potential repair of several mesodermally derived tissues such as fat, bone and cartilage. We hypothesized that obesity would alter the frequency, proliferation, multipotency and immunophenotype of adult stem cells from a variety of tissues. MATERIALS AND METHODS: Bone marrow-derived mesenchymal stem cells (MSCs), subcutaneous adipose-derived stem cells (sqASCs) and infrapatellar fat pad-derived stem cells (IFP cells) were isolated from lean and high-fat diet-induced obese mice, and their cellular properties were examined. To test the hypothesis that changes in stem cell properties were due to the increased systemic levels of free fatty acids (FFAs), we further investigated the effects of FFAs on lean stem cells in vitro. RESULTS: Obese mice showed a trend toward increased prevalence of MSCs and sqASCs in the stromal tissues. While no significant differences in cell proliferation were observed in vitro, the differentiation potential of all types of stem cells was altered by obesity. MSCs from obese mice demonstrated decreased adipogenic, osteogenic and chondrogenic potential. Obese sqASCs and IFP cells showed increased adipogenic and osteogenic differentiation, but decreased chondrogenic ability. Obese MSCs also showed decreased CD105 and increased platelet-derived growth factor receptor α expression, consistent with decreased chondrogenic potential. FFA treatment of lean stem cells significantly altered their multipotency but did not completely recapitulate the properties of obese stem cells. CONCLUSIONS: These findings support the hypothesis that obesity alters the properties of adult stem cells in a manner that depends on the cell source. These effects may be regulated in part by increased levels of FFAs, but may involve other obesity-associated cytokines. These findings contribute to our understanding of mesenchymal tissue remodeling with obesity, as well as the development of autologous stem cell therapies for obese patients.

A quantitative proteomic and transcriptomic comparison of human mesenchymal stem cells from bone marrow and umbilical cord vein

Human mesenchymal stem cells (hMSCs) are adult multipotent cells that have high therapeutic potential due to their immunological properties. They can be isolated from several different tissues with bone marrow (BM) being the most common source. Because the isolation procedure is invasive, other tissues such as human umbilical cord vein (UCV) have been considered. However, their interchangeability remains unclear. In the present study, total protein extracts of BM-hMSCs and UCV-hMSCs were quantitatively compared using gel-LC-MS/MS. Previous SAGE analysis of the same cells was re-annotated to enable comparison and combination of these two data sets. We observed a more than 63% correlation between proteomic and transcriptomic data. In silico analysis of highly expressed genes in cells of both origins suggests that they can be modulated by microRNA, which can change protein abundance. Our results showed that MSCs from both tissues shared high similarity in metabolic and functional processes relevant to their therapeutic potential, especially in the immune system process, response to stimuli, and processes related to the delivery of the hMSCs to a given tissue, such as migration and adhesion. Hence, our results support the idea that the more accessible UCV could be a potentially less invasive source of MSCs.

Identification and isolation of small CD44-negative mesenchymal stem/progenitor cells from human bone marrow using elutriation and polychromatic flow cytometry

The method of isolation of bone marrow (BM) mesenchymal stem/stromal cells (MSCs) is a limiting factor in their study and therapeutic use. MSCs are typically expanded from BM cells selected on the basis of their adherence to plastic, which results in a heterogeneous population of cells. Prospective identification of the antigenic profile of the MSC population(s) in BM that gives rise to cells with MSC activity in vitro would allow the preparation of very pure populations of MSCs for research or clinical use. To address this issue, we used polychromatic flow cytometry and counterflow centrifugal elutriation to identify a phenotypically distinct population of mesenchymal stem/progenitor cells (MSPCs) within human BM. The MSPC activity resided within a population of rare, small CD45⁻CD73⁺CD90⁺CD105⁺ cells that lack CD44, an antigen that is highly expressed on culture-expanded MSCs. In culture, these MSPCs adhere to plastic, rapidly proliferate, and acquire CD44 expression. They form colony forming units-fibroblast and are able to differentiate into osteoblasts, chondrocytes, and adipocytes under defined in vitro conditions. Their acquired expression of CD44 can be partially downregulated by treatment with recombinant human granulocyte-colony stimulating factor, a response not found in BM-MSCs derived from conventional plastic adherence methods. These observations indicate that MSPCs within human BM are rare, small CD45⁻CD73⁺CD90⁺CD105⁺ cells that lack expression of CD44. These MSPCs give rise to MSCs that have phenotypic and functional properties that are distinct from those of BM-MSCs purified by plastic adherence.

HGF Expressing Stem Cells in Usual Interstitial Pneumonia Originate from the Bone Marrow and Are Antifibrotic

BACKGROUND Pulmonary fibrosis may result from abnormal alveolar wound repair after injury. Hepatocyte growth factor (HGF) improves alveolar epithelial wound repair in the lung. Stem cells were shown to play a major role in lung injury, repair and fibrosis. We studied the presence, origin and antifibrotic properties of HGF-expressing stem cells in usual interstitial pneumonia. METHODS Immunohistochemistry was performed in lung tissue sections and primary alveolar epithelial cells obtained from patients with usual interstitial pneumonia (UIP, n = 7). Bone marrow derived stromal cells (BMSC) from adult male rats were transfected with HGF, instilled intratracheally into bleomycin injured rat lungs and analyzed 7 and 14 days later. RESULTS In UIP, HGF was expressed in specific cells mainly located in fibrotic areas close to the hyperplastic alveolar epithelium. HGF-positive cells showed strong co-staining for the mesenchymal stem cell markers CD44, CD29, CD105 and CD90, indicating stem cell origin. HGF-positive cells also co-stained for CXCR4 (HGF+/CXCR4+) indicating that they originate from the bone marrow. The stem cell characteristics were confirmed in HGF secreting cells isolated from UIP lung biopsies. In vivo experiments showed that HGF-expressing BMSC attenuated bleomycin induced pulmonary fibrosis in the rat, indicating a beneficial role of bone marrow derived, HGF secreting stem cells in lung fibrosis. CONCLUSIONS HGF-positive stem cells are present in human fibrotic lung tissue (UIP) and originate from the bone marrow. Since HGF-transfected BMSC reduce bleomycin induced lung fibrosis in the bleomycin lung injury and fibrosis model, we assume that HGF-expressing, bone-marrow derived stem cells in UIP have antifibrotic properties.

Delta like ligand 4 is a critical regulator of bone marrow cell differentiation into pericytes/vascular smooth muscle cells and is essential for the vasculogenesis that supports the growth of Ewing’s sarcoma

We have previously shown that vasculogenesis, the process by which bone marrow-derived cells are recruited to the tumor and organized to form a blood vessel network de novo, is essential for the growth of Ewing’s sarcoma. We further demonstrated that these bone marrow cells differentiate into pericytes/vascular smooth muscle cells(vSMC) and contribute to the formation of the functional vascular network. The molecular mechanisms that control bone marrow cell differentiation into pericytes/vSMC in Ewing’s sarcoma are poorly understood. Here, we demonstrate that the Notch ligand Delta like ligand 4 (DLL4) plays a critical role in this process. DLL4 is essential for the formation of mature blood vessels during development and in several tumor models. Inhibition of DLL4 causes increased vascular sprouting, decreased pericyte coverage, and decreased vessel functionality. We demonstrate for the first time that DLL4 is expressed by bone marrow-derived pericytes/vascular smooth muscle cells in two Ewing’s sarcoma xenograft models and by perivascular cells in 12 out of 14 patient samples. Using dominant negative mastermind to inhibit Notch, we demonstrate that Notch signaling is essential for bone marrow cell participation in vasculogenesis. Further, inhibition of DLL4 using either shRNA or the monoclonal DLL4 neutralizing antibody YW152F led to dramatic changes in blood vessel morphology and function. Vessels in tumors where DLL4 was inhibited were smaller, lacked lumens, had significantly reduced numbers of bone marrow-derived pericyte/vascular smooth muscle cells, and were less functional. Importantly, growth of TC71 and A4573 tumors was significantly inhibited by treatment with YW152F. Additionally, we provide in vitro evidence that DLL4-Notch signaling is involved in bone marrow-derived pericyte/vascular smooth muscle cell formation outside of the Ewing’s sarcoma environment. Pericyte/vascular smooth muscle cell marker expression by whole bone marrow cells cultured with mouse embryonic stromal cells was reduced when DLL4 was inhibited by YW152F. For the first time, our findings demonstrate a role for DLL4 in bone marrow-derived pericyte/vascular smooth muscle differentiation as well as a critical role for DLL4 in Ewing’s sarcoma tumor growth.

Three-dimensional culture and characterization of mononuclear cells from human bone marrow

BACKGROUND AIMS The diverse phenotypic changes and clinical and economic disadvantages associated with the monolayer expansion of bone marrow-derived mesenchymal stromal cells (MSCs) have focused attention on the development of one-step intraoperative cells therapies and homing strategies. The mononuclear cell fraction of bone marrow, inclusive of discrete stem cell populations, is not well characterized, and we currently lack suitable cell culture systems in which to culture and investigate the behavior of these cells. METHODS Human bone marrow-derived mononuclear cells were cultured within fibrin for 2 weeks with or without fibroblast growth factor-2 supplementation. DNA content and cell viability of enzymatically retrieved cells were determined at days 7 and 14. Cell surface marker profiling and cell cycle analysis were performed by means of multi-color flow cytometry and a 5-ethynyl-2'-deoxyuridine incorporation assay, respectively. RESULTS Total mononuclear cell fractions, isolated from whole human bone marrow, was successfully cultured in fibrin gels for up to 14 days under static conditions. Discrete niche cell populations including MSCs, pericytes and hematopoietic stem cells were maintained in relative quiescence for 7 days in proportions similar to that in freshly isolated cells. Colony-forming unit efficiency of enzymatically retrieved MSCs was significantly higher at day 14 compared to day 0; and in accordance with previously published works, it was fibroblast growth factor-2-dependant. CONCLUSIONS Fibrin gels provide a simple, novel system in which to culture and study the complete fraction of bone marrow-derived mononuclear cells and may support the development of improved bone marrow cell-based therapies.

The effects of pore architecture in silk fibroin scaffolds on the growth and differentiation of mesenchymal stem cells expressing BMP7

The pore architecture of scaffolds is known to play a critical role in tissue engineering as it provides the vital framework for seeded cells to organize into a functioning tissue. In this report we have investigated the effects of different concentrations of silk fibroin protein on three-dimensional (3D) scaffold pore microstructure. Four pore size ranges of silk fibroin scaffolds were made by the freeze drying technique, with the pore sizes ranging from 50 to 300 lm. The pore sizes of the scaffolds decreased as the concentration of fibroin protein increased. Human bone marrow mesenchymal stromal cells (BMSC) transfected with the BMP7 gene were cultured in these scaffolds. A cell viability colorimetric assay, alkaline phosphatase assay and reverse transcription-polymerase chain reaction were performed to analyze the effect of pore size on cell growth, the secretion of extracellular matrix (ECM) and osteogenic differentiation. Cell migration in 3D scaffolds was confirmed by confocal microscopy. Calvarial defects in SCID mice were used to determine the bone forming ability of the silk fibroin scaffolds incorporating BMSC expressing BMP7. The results showed that BMSC expressing BMP7 preferred a pore size between 100 and 300 lm in silk fibroin protein fabricated scaffolds, with better cell proliferation and ECM production. Furthermore, in vivo transplantation of the silk fibroin scaffolds combined with BMSC expressing BMP7 induced new bone formation. This study has shown that an optimized pore architecture of silk fibroin scaffolds can modulate the bioactivity of BMP7-transfected BMSC in bone formation.

3D mesenchymal stem/stromal cell osteogenesis and autocrine signalling

Mesenchymal stem/stromal cells (MSC) are rapidly becoming a leading candidate for use in tissue regeneration, with first generation of therapies being approved for use in orthopaedic repair applications. Capturing the full potential of MSC will likely require the development of novel in vitro culture techniques and devices. Herein we describe the development of a straightforward surface modification of an existing commercial product to enable the efficient study of three dimensional (3D) human bone marrow-derived MSC osteogenic differentiation. Hundreds of 3D microaggregates, of either 42 or 168 cells each, were cultured in osteogenic induction medium and their differentiation was compared with that occurring in traditional two dimensional (2D) monolayer cultures. Osteogenic gene expression and matrix composition was significantly enhanced in the 3D microaggregate cultures. Additionally, BMP-2 gene expression was significantly up-regulated in 3D cultures at day 3 and 7 by approximately 25- and 30-fold, respectively. The difference in BMP-2 gene expression between 2D and 3D cultures was negligible in the more mature day 14 osteogenic cultures. These data support the notion that BMP-2 autocrine signalling is up-regulated in 3D MSC cultures, enhancing osteogenic differentiation. This study provides both mechanistic insight into MSC differentiation, as well as a platform for the efficient generation of microtissue units for further investigation or use in tissue engineering applications.

Stage-specific embryonic antigen-4 is not a marker for chondrogenic and osteogenic potential in cultured chondrocytes and mesenchymal progenitor cells

One important challenge for regenerative medicine is to produce a clinically relevant number of cells with consistent tissue-forming potential. Isolation and expansion of cells from skeletal tissues results in a heterogeneous population of cells with variable regenerative potential. A more consistent tissue formation could be achieved by identification and selection of potent progenitors based on cell surface molecules. In this study, we assessed the expression of stage-specific embryonic antigen-4 (SSEA-4), a classic marker of undifferentiated stem cells, and other surface markers in human articular chondrocytes (hACs), osteoblasts, and bone marrow-derived mesenchymal stromal cells (bmMSCs) and characterized their differentiation potential. Further, we sorted SSEA-4-expressing hACs and followed their potential to proliferate and to form cartilage in vitro. Cells isolated from cartilage and bone exhibited remarkably heterogeneous SSEA-4 expression profiles in expansion cultures. SSEA-4 expression levels increased up to approximately 5 population doublings, but decreased following further expansion and differentiation cultures; levels were not related to the proliferation state of the cells. Although SSEA-4-sorted chondrocytes showed a slightly better chondrogenic potential than their SSEA-4-negative counterparts, differences were insufficient to establish a link between SSEA-4 expression and chondrogenic potential. SSEA-4 levels in bmMSCs also did not correlate to the cells' chondrogenic and osteogenic potential in vitro. SSEA-4 is clearly expressed by subpopulations of proliferating somatic cells with a MSC-like phenotype. However, the predictive value of SSEA-4 as a specific marker of superior differentiation capacity in progenitor cell populations from adult human tissue and even its usefulness as a stem cell marker appears questionable.

Mesenchymal stem cells and nano-structured surfaces

Mesenchymal stem cells (MSCs) represent multipotent stromal cells that can differentiate into a variety of cell types, including osteoblasts (bone cells), chondrocytes (cartilage cells), and adipocytes (fat cells). Their multi-potency provides a great promise as a cell source for tissue engineering and cell-based therapy for many diseases, particularly bone diseases and bone formation. To be able to direct and modulate the differentiation of MSCs into the desired cell types in situ in the tissue, nanotechnology is introduced and used to facilitate or promote cell growth and differentiation. These nano-materials can provide a fine structure and tuneable surface in nanoscales to help the cell adhesion and promote the cell growth and differentiation of MSCs. This could be a dominant direction in future for stem cells based therapy or tissue engineering for various diseases. Therefore, the isolation, manipulation, and differentiation of MSCs are very important steps to make meaningful use of MSCs for disease treatments. In this chapter, we have described a method of isolating MSC from human bone marrow, and how to culture and differentiate them in vitro. We have also provided research methods on how to use MSCs in an in vitro model and how to observe MSC biological response on the surface of nano-scaled materials.

Direct bone marrow HSC transplantation enhances local engraftment at the expense of systemic engraftment in NSG mice

Direct bone marrow (BM) injection has been proposed as a strategy to bypass homing inefficiencies associated with intravenous (IV) hematopoietic stem cell (HSC) transplantation. Despite physical delivery into the BM cavity, many donor cells are rapidly redistributed by vascular perfusion, perhaps compromising efficacy. Anchoring donor cells to 3-dimensional (3D) multicellular spheroids, formed from mesenchymal stem/stromal cells (MSC) might improve direct BM transplantation. To test this hypothesis, relevant combinations of human umbilical cord blood-derived CD34(+) cells and BM-derived MSC were transplanted into NOD/SCID gamma (NSG) mice using either IV or intrafemoral (IF) routes. IF transplantation resulted in higher human CD45(+) and CD34(+) cell engraftment within injected femurs relative to distal femurs regardless of cell combination, but did not improve overall CD45(+) engraftment at 8 weeks. Analysis within individual mice revealed that despite engraftment reaching near saturation within the injected femur, engraftment at distal hematopoietic sites including peripheral blood, spleen and non-injected femur, could be poor. Our data suggest that the retention of human HSC within the BM following direct BM injection enhances local chimerism at the expense of systemic chimerism in this xenogeneic model.