987 resultados para Dem gross error detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Ankle sprains are the most common injuries in sports, usually causing damage to the lateral ligaments. Recurrence has as usual result permanent instability, and thus loss of proprioception. This fact, together with residual symptoms, is what is known as chronic ankle instability, CAI, or FAI, if it is functional. This problem tries to be solved by improving musculoskeletal stability and proprioception by the application of bandages and performing exercises. The aim of this study has been to review articles (meta-analisis, systematic reviews and revisions) published in 2009-2015 in PubMed, Medline, ENFISPO and BUCea, using keywords such as “sprain instability”, “sprain proprioception”, “chronic ankle instability”. Evidence affirms that there does exist decreased proprioception in patients who suffer from CAI. Rehabilitation exercise regimen is indicated as a treatment because it generates a subjective improvement reported by the patient, and the application of bandages works like a sprain prevention method limiting the range of motion, reducing joint instability and increasing confidence during exercise. As podiatrists we should recommend proprioception exercises to all athletes in a preventive way, and those with CAI or FAI, as a rehabilitation programme, together with the application of bandages. However, further studies should be generated focusing on ways of improving proprioception, and on the exercise patterns that provide the maximum benefit.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

AIRES, Kelson R. T. ; ARAÚJO, Hélder J. ; MEDEIROS, Adelardo A. D. . Plane Detection from Monocular Image Sequences. In: VISUALIZATION, IMAGING AND IMAGE PROCESSING, 2008, Palma de Mallorca, Spain. Proceedings..., Palma de Mallorca: VIIP, 2008

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We consider an LTE network where a secondary user acts as a relay, transmitting data to the primary user using a decode-and-forward mechanism, transparent to the base-station (eNodeB). Clearly, the relay can decode symbols more reliably if the employed precoder matrix indicators (PMIs) are known. However, for closed loop spatial multiplexing (CLSM) transmit mode, this information is not always embedded in the downlink signal, leading to a need for effective methods to determine the PMI. In this thesis, we consider 2x2 MIMO and 4x4 MIMO downlink channels corresponding to CLSM and formulate two techniques to estimate the PMI at the relay using a hypothesis testing framework. We evaluate their performance via simulations for various ITU channel models over a range of SNR and for different channel quality indicators (CQIs). We compare them to the case when the true PMI is known at the relay and show that the performance of the proposed schemes are within 2 dB at 10% block error rate (BLER) in almost all scenarios. Furthermore, the techniques add minimal computational overhead over existent receiver structure. Finally, we also identify scenarios when using the proposed precoder detection algorithms in conjunction with the cooperative decode-and-forward relaying mechanism benefits the PUE and improves the BLER performance for the PUE. Therefore, we conclude from this that the proposed algorithms as well as the cooperative relaying mechanism at the CMR can be gainfully employed in a variety of real-life scenarios in LTE networks.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This article is concerned with the numerical detection of bifurcation points of nonlinear partial differential equations as some parameter of interest is varied. In particular, we study in detail the numerical approximation of the Bratu problem, based on exploiting the symmetric version of the interior penalty discontinuous Galerkin finite element method. A framework for a posteriori control of the discretization error in the computed critical parameter value is developed based upon the application of the dual weighted residual (DWR) approach. Numerical experiments are presented to highlight the practical performance of the proposed a posteriori error estimator.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND Herpesvirus and poxvirus can infect a wide range of species: herpesvirus genetic material has been detected and amplified in five species of the superfamily Pinnipedia; poxvirus genetic material, in eight species of Pinnipedia. To date, however, genetic material of these viruses has not been detected in walrus (Odobenus rosmarus), another marine mammal of the Pinnipedia clade, even though anti-herpesvirus antibodies have been detected in these animals. CASE PRESENTATION In February 2013, a 9-year-old healthy captive female Pacific walrus died unexpectedly at L'Oceanografic (Valencia, Spain). Herpesvirus was detected in pharyngeal tonsil tissue by PCR. Phylogenetic analysis revealed that the virus belongs to the subfamily Gammaherpesvirinae. Poxvirus was also detected by PCR in skin, pre-scapular and tracheobronchial lymph nodes and tonsils. Gross lesions were not detected in any tissue, but histopathological analyses of pharyngeal tonsils and lymph nodes revealed remarkable lymphoid depletion and lymphocytolysis. Similar histopathological lesions have been previously described in bovine calves infected with an alphaherpesvirus, and in northern elephant seals infected with a gammaherpesvirus that is closely related to the herpesvirus found in this case. Intracytoplasmic eosinophilic inclusion bodies, consistent with poxviral infection, were also observed in the epithelium of the tonsilar mucosa. CONCLUSION To our knowledge, this is the first molecular identification of herpesvirus and poxvirus in a walrus. Neither virus was likely to have contributed directly to the death of our animal.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Acoustic Emission (AE) monitoring can be used to detect the presence of damage as well as determine its location in Structural Health Monitoring (SHM) applications. Information on the time difference of the signal generated by the damage event arriving at different sensors is essential in performing localization. This makes the time of arrival (ToA) an important piece of information to retrieve from the AE signal. Generally, this is determined using statistical methods such as the Akaike Information Criterion (AIC) which is particularly prone to errors in the presence of noise. And given that the structures of interest are surrounded with harsh environments, a way to accurately estimate the arrival time in such noisy scenarios is of particular interest. In this work, two new methods are presented to estimate the arrival times of AE signals which are based on Machine Learning. Inspired by great results in the field, two models are presented which are Deep Learning models - a subset of machine learning. They are based on Convolutional Neural Network (CNN) and Capsule Neural Network (CapsNet). The primary advantage of such models is that they do not require the user to pre-define selected features but only require raw data to be given and the models establish non-linear relationships between the inputs and outputs. The performance of the models is evaluated using AE signals generated by a custom ray-tracing algorithm by propagating them on an aluminium plate and compared to AIC. It was found that the relative error in estimation on the test set was < 5% for the models compared to around 45% of AIC. The testing process was further continued by preparing an experimental setup and acquiring real AE signals to test on. Similar performances were observed where the two models not only outperform AIC by more than a magnitude in their average errors but also they were shown to be a lot more robust as compared to AIC which fails in the presence of noise.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

77

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física