Efeito de glucanas do fungo Caripia montagnei em modelo de inflamação intestinal induzida por tnbs em ratos Wistar e em células de carcinoma de cólon humano HT-29

Compounds derived from fungi has been the subject of many studies in order to broaden the knowledge of their bioactive potential. Polysaccharides from Caripia montagnei have been described to possess anti-inflammatory and antioxidant properties. In this study, glucans extracted from Caripia montagnei mushroom were chemically characterized and their effects evaluated at different doses and intervals of treatment. It was also described their action on colonic injury in the model of colitis induced by 2,4,6-trinitrobenzene sulfonic acid (TNBS), and its action on cells of the human colon carcinoma (HT-29). Compounds extracted of C. montagnei contain high level of carbohydrates (96%), low content of phenolic compounds (1.5%) and low contamination with proteins (2.5%). The (FT-IR) and (NMR) analysis showed that polysaccharides from this species of mushroom are composed of α- and β-glucans. The colonic damage was evaluated by macroscopic, histological, biochemical and immunologic analyses. The results showed a reduction of colonic lesions in all groups treated with the glucans of Caripia montagnei (GCM). GCM significantly reduced the levels of IL-6 (50 and 75 mg/kg, p < 0.05), a major inflammatory cytokine. Biochemical analyses showed that such glucans acted on reducing levels of alkaline phosphatase (75 mg/kg, p < 0.01), nitric oxide (p < 0.001), and myeloperoxidase (p < 0.001). These results were confirmed microscopically by the reduction of cellular infiltration. The increase of catalase activity suggest a protective effect of GCM on colonic tissue, confirming their anti-inflammatory potential. GCM displayed cytostatic activity against HT-29 cells, causing accumulation of cells in G1 phase, blocking the cycle cell progression. Those glucans also showed ability to modulate the adhesion of HT-29 cells to Matrigel® and reduced the oxidative stress. The antiproliferative activity against HT-29 cells displayed by GCM (p <0.001) can be attributed to its cytostatic activity and induction of apoptosis by GCM

Produção e caracterização de quitooligossacarídeos produzidos pelo fungo Metarhizium anisopliae e avaliação da citotoxicidade em células tumorais

Chitosan is a natural polymer, biodegradable, nontoxic, high molecular weight derived from marine animals, insects and microorganisms. Oligomers of glucosamine (GlcN) and N-acetylglucosamine (GlcNAc) have interesting biological activities, including antitumor effects, antimicrobial activity, antioxidant and others. The alternative proposed by this work was to study the viability of producing chitooligosaccharides using a crude enzymes extract produced by the fungus Metarhizium anisopliae. Hydrolysis of chitosan was carried out at different times, from 10 to 60 minutes to produce chitooligosaccharides with detection and quantification performed by High Performace Liquid Chromatography (HPLC). The evaluation of cytotoxicity of chitosan oligomers was carried out in tumor cells (HepG2 and HeLa) and non-tumor (3T3). The cells were treated for 72 hours with the oligomers and cell viability investigated using the method of MTT. The production of chitosan oligomers was higher for 10 minutes of hydrolysis, with pentamers concentration of 0.15 mg/mL, but the hexamers, the molecules showing greater interest in biological properties, were observed only with 30 minutes of hydrolysis with a concentration of 0.004 mg/mL. A study to evaluate the biological activities of COS including cytotoxicity in tumor and normal cells and various tests in vitro antioxidant activity of pure chitosan oligomers and the mixture of oligomers produced by the crude enzyme was performed. Moreover, the compound with the highest cytotoxicity among the oligomers was pure glucosamine, with IC50 values of 0.30; 0.49; 0.44 mg/mL for HepG2 cells, HeLa and 3T3, respectively. Superoxide anion scavenging was the mainly antioxidant activity showed by the COS and oligomers. This activity was also depending on the oligomer composition in the chitosan hydrolysates. The oligomers produced by hydrolysis for 20 minutes was analyzed for the ability to inhibit tumor cells showing inhibition of proliferation only in HeLa cells, did not show any effect in HepG2 cells and fibroblast cells (3T3)

O papel do inflamassoma na infecção induzida pelas formas saprofíticas do fungo Fonsecaea pedrosoi

Dissertação (mestrado)—Universidade de Brasília, Faculdade de Medicina, Programa de Pós-Graduação em Patologia Molecular, 2016.

Efeito do fungo Metarhizium anisopliae (Metsch.) Sorok. (Deuteromycetes) para Astyanax scabripinnis (Jenyns, 1842) (Pisces: Characidae).

Avaliou-se o efeito de Metarhizium anisopliae (Metsch.) para Astyanax scabripinnis (Jenyns, 1842)(Pisces, Characidae), em condições de laboratório. Suspensões aquosas de conídios recémproduzidos, viáveis (viabilidade mínima 90%) e inviabilizados por meio de autoclavagem (121º C, 20 minutos, a 1 atm), na concentração de 6,5 x 1010 conídios/aquário (equivalente a 5 x 1015 conídios/ ha, que representa 1.000 vezes a concentração recomendada para o controle de cigarrinhas de pastagens, principal praga-alvo deste entomopatógeno no Brasil), foram aplicadas em aquários contendo A. scabripinnis. Foram analisadas amostras de água e dos peixes, dos quais foram dissecados as brânquias e o estômago, em diferentes intervalos de tempo, a fim de se avaliar a presença dos conídios. Observaram-se diariamente o comportamento e a mortalidade de peixes em ambos os tratamentos. Avaliou-se nos peixes sobreviventes a morfologia das células das brânquias e do fígado. Verificou-se que nas brânquias não houve alteração no número de conídios ao longo de 16 dias de contato, sendo que no estômago houve um ligeiro acréscimo inicial seguido de redução constante. A viabilidade dos conídios em todos os locais avaliados decresceu após 24 horas da aplicação. Constatou-se que não houve morte ou quaisquer alterações comportamentais após 30 dias de contato, indicando a ausência de efeitos adversos associados à capacidade do fungo em provocar infecção ou exercer efeitos tóxicos em ambos os organismos-teste.

Avaliação do extrato do fungo caripia montagnei e de agonistas de PPAR - α no processo inflamatório

The mushrooms have been object of intense research in view of its potential raising of application in different sectors of the pharmacology and alimentary industry. Among diverse bioactive composites of polyssacharides nature that exist in the fungus the glucans are much searched. These are polymers of glucose and classified as the type of glicosidic linking [α, β]. Peroxisome proliferator-activated receptors (PPARs), ranscription factors belonging to the family of nuclear receptors that bind themselves o specific agonists, have shown their importance in controlling the inflammatory process. The aim of this study was to perform a chemical characterization of extract rom the mushroom Caripia montagnei, assess its antiinflammatory and antibacterial effect and determine if this effect occurs via PPAR. This mushroom is composed of carbohydrates (63.3±4.1%), lipids (21.4l±0.9%) and proteins (2.2± 0.3%). The aqueous solution resulting from the fractionation contained carbohydrates (98.7±3.3%) and protein (1.3±0.25%). Analyses of infrared spectrophotometry and of nuclear magnetic esonance demonstrated that the extract of mushroom C. montagnei is rich in β-glucans. In hioglycolate-induced peritonitis, the C. montagnei glucans (50 mg/kg) educed the inflammatory process in 65.5±5.2% and agonists, pharmacological igands, for PPAR: Wy-14643 (49.3±6.1%), PFOA (48.9±3.8%) and clofibrate in 45.2±3.2%. Sodium diclofenac showed a reduction of 81.65±0.6%. In the plantar edema, the glucans from C. montagnei (50 mg/kg) and L-NAME reduced the edema to a similar degree 91.4±0.3% and 92.8±0,5 %, respectively. In all the groups tested, nitric oxide (NO), an inflammation mediator, showed a significant reduction in the nitrate/nitrite levels when compared to the positive control (P<0.001). The C. montagnei glucans did not show cytotoxicity in the concentrations tested (2.5, 5.0, 10.0, 20.0 and 40.0 µg/100 µL). Antibacterial activity demonstrated that, unlike total extract, there was no inhibition of bacterial growth. The C. montagnei glucans show great potential for antiinflammatory applications. This effect suggests that it is mediated by PPAR activation and by COX and iNOS inhibition

Bactérias endofíticas do morangueiro antagônicas ao fungo Pestalotiopsis longisetula.

2008

Estabelecimento de metodologia para análise e quantificação da colonização por fungo micorrízico arbuscular em milho.

2016

Resistência de genótipos de sorgo sacarino à mancha de ramulispora foliar causada pelo fungo Ramulispora sorghi, no Estado de Mato Grosso (Cáceres).

2016

Ocorrência de fungos filamentosos termo-resistentes em polpa de tomate envasada assepticamente

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

Larva of Atractocerus Brasiliensis (Lepeletier & Audinet-Serville, 1825) (Lymexylidae, Atractocerinae)

The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.

A new species of the fungus-farming ant genus Mycetagroicus Brandão & Mayhé-Nunes (Hymenoptera, Formicidae, Attini)

The fungus-farming ant genus Mycetagroicus Brandão & Mayhé-Nunes was proposed based on three species from the Brazilian "Cerrado": M. cerradensis, M. triangularis and M. urbanus. Here we describe a new species of Attini ant of the genus Mycetagroicus, M. inflatus n. sp., based on two workers collected in eastern Pará State, Brazil. A new key for species identification, comments on differences among species and new geographical distribution data are furnished.

Seroprevalence of Rickettsia bellii and Rickettsia felis in dogs, São José dos Pinhais, State of Paraná, Brazil

Brazilian spotted fever (BSF) is a vector-borne zoonosis caused by Rickettsia rickettsii bacteria. Dogs can be host sentinels for this bacterium. The aim of the study was to determine the presence of antibodies against Rickettsia spp. in dogs from the city of São José dos Pinhais, State of Paraná, Southern Brazil, where a human case of BSF was first reported in the state. Between February 2006 and July 2007, serum samples from 364 dogs were collected and tested at 1:64 dilutions by indirect immunofluorescence assay (IFA) against R. rickettsii and R. parkeri. All sera that reacted at least to one of Rickettsia species were tested against the six main Rickettsia species identified in Brazil: R. rickettsii, R. parkeri, R. bellii, R. rhipicephali, R. amblyommii and R. felis. Sixteen samples (4.4%) reacted to at least one Rickettsia species. Among positive animals, two dogs (15.5%) showed suggestive titers for R. bellii exposure. One sample had a homologous reaction to R. felis, a confirmed human pathogen. Although Rickettsia spp. circulation in dogs in the area studied may be considered at low prevalence, suggesting low risk of human infection, the present data demonstrate for the first time the exposure of dogs to R. bellii and R. felis in Southern Brazil.

Heartworm (Dirofilaria immitis) disease in a Brazilian oncilla (Leopardus tigrinus)

Heartworm disease is caused by the intravascular nematode Dirofilaria immitis, a pathogen of public health importance usually associated to domestic dogs and cats, and to a lesser extend to other mammal species. The oncilla (Leopardus tigrinus) is a threatened neotropic felid species that naturally occurs in Brazil. Here, we report the encounter of adult and larval stages of heartworms in a female specimen of L. tigrinus, probable of free-ranging origin, from Ubatuba, São Paulo, Brazil, which died showing clinical signals compatible with heartworm disease. This was the first reported case of D. immitis infection and associated disease in L. tigrinus, also suggesting that the oncilla acted as a definitive host for this parasite. The present findings confirmed D. immitis as a pathogenic agent for this felid species, thus supporting the recommendation for the inclusion of diagnostic testing for this pathogen in routine health screening procedures for captive and free-ranging oncillas in Brazil, especially in those localities where climate conditions support the occurrence of the parasite. Potential reservoirs as oncillas are established beyond the reach of veterinary care, thus representing a continuing risk for domestic animals and humans acquiring heartworm infection. We encourage further serologic and molecular studies aiming to establish D. immitis prevalences in L. tigrinus and other wild carnivores in the region of Ubatuba, as well as ecological and veterinary studies to access the role of this pathogen for the survival of this threatened felid species.