958 resultados para cause specific survival


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Aim: HER-2/neu amplification occurs in 15-25% of breast carcinomas. This oncogene, also referred to as c-erbB-2, encodes a transmembrane tyrosine kinase receptor belonging to the epidermal growth factor receptor family. HER-2 over-expression is reported to be associated with a poor prognosis in breast carcinoma patients and in some studies is associated with a poorer response to anti-oestrogen therapy. These patients are less likely to benefit from CMF (cyclophosphamide, methotrexate, fluorouracil)-based chemotherapy compared with anthracycline-based chemotherapy. The aim of this study was to evaluate breast carcinomas to determine hormone receptor status and if there is a difference in breast cancer specific survival for HER-2 positive patients. Methods: A total of 591 breast carcinomas were evaluated using immunohistochemistry (IHC) for oestrogen receptor (ERp), progesterone receptor (PRp) and three different HER2 antibodies (CB11, A0485 and TAB250). Percentage of tumour cells and intensity of staining for ERp were evaluated using a semiquantitative method. Results: Of the 591 tumours, 91 (15.4%) showed 3+ membrane staining for HER-2 with one or more antibodies. Of these 91 tumours, 41 (45.1%) were ERp+/ PRp+, seven (7.7%) were ERp+/PR-, six (6.6%) were ERp-/PRp+ and 37 (40.7%) were ERp-/PR-. Of HER-2 positive tumours, 5.5% showed > 80% 3+ staining for ERp compared with 31.8% of 0-2+ HER-2 tumours; 24.2% of HER-2-positive tumours showed 60% or more cells with 2+ or 3+ staining for ERp. Treatment data were available for 209 patients and no difference was observed in breast cancer specific survival (BCSS) with HER-2 status and tamoxifen. Conclusion: Oestrogen receptor status cannot be used to select tumours for evaluation of HER-2 status, and oestrogen and progesterone receptor positivity does not preclude a positive HER-2 status. There is a higher proportion of ERp negative tumours associated with HER-2 positivity, however, more than 20% of HER-2 positive tumours show moderate or strong staining for ERp. HER-2 positive patients in this study did not show an adverse BCSS with tamoxifen treatment unlike some previous studies.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Patterns of mangrove vegetation in two distinct basins of Florida Coastal Everglades (FCE), Shark River estuary and Taylor River Slough, represent unique opportunities to test hypotheses that root dynamics respond to gradients of resources, regulators, and hydroperiod. We propose that soil total phosphorus (P) gradients in these two coastal basins of FCE cause specific patterns in belowground biomass allocation and net primary productivity that facilitate nutrient acquisition, but also minimize stress from regulators and hydroperiod in flooded soil conditions. Shark River basin has higher P and tidal hydrology with riverine mangroves, in contrast to scrub mangroves of Taylor basin with more permanent flooding and lower P across the coastal landscape. Belowground biomass (0–90 cm) of mangrove sites in Shark River and Taylor River basins ranged from 2317 to 4673 g m-2, with the highest contribution (62–85%) of roots in the shallow root zone (0–45 cm) compared to the deeper root zone (45–90 cm). Total root productivity did not vary significantly among sites and ranged from 407 to 643 g m-2 y-1. Root production in the shallow root zone accounted for 57–78% of total production. Root turnover rates ranged from 0.04 to 0.60 y-1 and consistently decreased as the root size class distribution increased from fine to coarse roots, indicating differences in root longevity. Fine root biomass was negatively correlated with soil P density and frequency of inundation, whereas fine root turnover decreased with increasing soil N:P ratios. Lower P availability in Taylor River basin relative to Shark River basin, along with higher regulator and hydroperiod stress, confirms our hypothesis that interactions of stress from resource limitation and long duration of hydroperiod account for higher fine root biomass along with lower fine root production and turnover. Because fine root production and organic matter accumulation are the primary processes controlling soil formation and accretion in scrub mangrove forests, root dynamics in the P-limited carbonate ecosystem of south Florida have a major controlling role as to how mangroves respond to future impacts of sealevel rise.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Base excision repair (BER) and nucleotide excision repair (NER) pathways play critical role in maintaining genome integrity. Polymorphisms in BER and NER genes which modulate the DNA repair capacity may affect the susceptibility and prognosis of oral cancer. This study was conducted with genomic DNA from 92 patients with oral squamous cell carcinomas (OSCC) and 130 controls. The cases were followed up to explore the associations between BER and NER genes polymorphisms and the risk and prognosis of OSCC. Four single-nucleotide polymorphisms (SNPs) in XRCC1 (rs25487), APEX1 (rs1130409), XPD (rs13181) and XPF (rs1799797) genes were tested by polymerase chain reaction – quantitative real time method. The GraphPad Prism version 6.0.1 statistical software was applied for statistical analysis of association. Odds ratio (OR), hazard ratio (HR), and their 95 % confidence intervals (CIs) were calculated by logistic regression. Kaplan-Meier curve and Cox proportional hazard model were used for prognostic analysis. The presence of polymorphic variants in XRCC1, APEX1, XPD and XPF genes were not associated with an increased risk of OSCC. Gene-environment interactions with smoking were not significant for any polymorphism. The presence of polymorphic variants of the XPD gene in association with alcohol consumption conferred an increased risk of 1.86 (95% CI: 0.86 – 4.01, p=0.03) for OSCC. Only APEX1 was associated with decreased specific survival (HR 3.94, 95% CI: 1.31 – 11.88, p=0.01). These results suggest an interaction between polymorphic variants of the XPF gene and alcohol consumption. Additionally APEX1 may represent a prognostic marker for OSCC.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Intensification of aquaculture production in Uganda is likely to result into disease out-breaks leading to economic losses to commercial fish farms and associated natural aquatic ecosystems. This survey assessed health profiles of selected commercial fish farms and adjacent natural aquatic ecosystemsto identify fish diseases and parasites affecting Nile tilapia (Oreochromis niloticus) and African catfish (Clarias gariepinus) in aquaculture systems in Uganda. Fish farms encounter disease out-breaks that cause low survival rates (0 - 30%), especially catfish hatcheries. Health management issues are not well understood by fish farmers, with some unable to detect diseased fish. Current control strategies to control aquatic pathogens include use of chemotherapeutants and antibiotics. Bacterial pathogens isolated included Flavobacterium columnare, Aeromonas sp., Edwardsiella sp., Psuedomonus sp., Steptococcus sp., Staphylococcus sp., Proteus sp., and Vibrio sp. A high occurrence of Flavobacterium columnare exists in both asymptomatic and symptomatic fish was observed. Parasites included protozoans (Ichthyopthirius multiphilis, Trichodina sp. and Icthyobodo sp.) and trematodes (Cleidodiscus sp. and Gyrodactylus sp.). Diagnosis and control of diseases and parasites in aquaculture production systems requires adoption of a regional comprehensive biosecurity strategy: the East African (EAC) region unto which this study directly contributes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Colorectal cancer is a common, age-associated disease with significant comorbidity and mortality. Biomarkers of ageing may have prognostic or predictive value in colorectal cancer. Fetuin A, members of the sirtuin family of proteins and telomeres have shown promise as potential biomarkers of ageing. AIM: To evaluate these potential biomarkers in the context of colorectal cancer. METHODS: Two cohorts of patients were used. Telomere length was measured in peripheral blood leukocytes (PBL), and for a subset of patients, in normal colorectal and colorectal tumour tissue. Serum fetuin A was measured for these patients and data on clinico-pathological factors of accepted significance in colorectal cancer was collected prospectively. Telomere length in the matched samples of leukocytes, normal colorectal and colorectal tumour tissue was compared. Associations between telomere length in the different tissues, serum fetuin A and clinico-pathological factors of accepted significance in colorectal cancer were evaluated. A systematic review of the literature was performed to examine the evidence for correlation between telomere length in different tissues in humans. Tissue from colorectal tumours from the second cohort patients was mounted in a tissue microarray (TMA) and stained for sirtuin proteins (SIRT2-SIRT7). This TMA also contained tissue from a subset of matched samples of adjacent normal colorectal mucosa. Staining of normal colorectal and colorectal tumour tissue was evaluated by the weighted Histoscore method and compared. The effect of staining in tumour tissue on cancer-specific survival was examined. Associations between Histoscores and clinico-pathological factors of accepted significance in colorectal cancer were assessed. RESULTS: Systematic review of the literature did not show robust evidence of correlation between telomere length in different tissues in humans. Telomere length in peripheral blood leukocytes did not show correlation with telomere length in normal colorectal mucosa, or in colorectal tumour tissue. PBL telomere length was potentially related to the presence of distant metastases. Fetuin A was inversely associated with markers of systemic inflammation and with T stage. Novel nuclear localisation was described for SIRT4 and SIRT5. Protein expression of the sirtuins was reduced in tumour tissue in comparison to normal colorectal mucosa, apart from SIRT3 cytoplasmic and nuclear and SIRT6 nuclear stainng. Lowest and highest quartile SIRT2 expression was associated with worse survival. Sirtuin protein expression levels and localisation correlate with increased systemic inflammation and pathological markers of poor prognosis in tumour tissue. Intercorrelations between sirtuin expression levels in normal tissue are not seen in tumour tissue, possibly indicating a breakdown of signalling and control.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Colorectal cancer (CRC) is the second most common cancer in Europe, with the second highest mortality rate. Although prognosis is improving, survival rates remain poor for those presenting with the most advanced stages of the disease. There is therefore a need for improved early diagnosis and thus a greater understanding of the early stages of the development of colorectal tumours is desirable. Additionally, as most deaths in colorectal cancer are due to advanced metastatic disease, it is of great interest to explore any potential mechanisms by which metastatic disease can be inhibited. N-WASP is a ubiquitously expressed protein with multiple intracellular roles including actin regulation and maintaining stability of epithelial cell-cell junctions. Through its role as an actin regulator, it has been implicated in the processes of invasion and metastasis of multiple cancer types. Its role in the development and progression of colorectal cancer however has not been fully explored. This thesis will present a series of in vitro and in vivo studies that were carried out with the aim of answering the following questions: • Does N-Wasp have a role in normal intestinal homeostasis? • Does N-Wasp knockout affect the development of tumours in a mouse model of intestinal tumourigenesis? • Does N-Wasp knockout affect the invasive properties of intestinal cancer in vitro? • Does N-WASP correlate with prognosis or other indicators in human colorectal cancer TMAs? Findings from the in vivo experiments, using an inducible, gut-specific knockout model, have uncovered potential roles for N-Wasp in regulating differentiation and migration of intestinal epithelial cells. Although it had no effect in short term models of intestinal hyperproliferation, N-Wasp knockout increased tumour burden and decreased survival in an established in vivo model of intestinal tumourigenesis, in which there is heterozygous loss of Apc (Apcfl/+). No effect was seen on tumour development or survival when additional N-WASP knockout was introduced into a more rapid model, with heterozygous loss of Apc and mutation of Kras (Apcfl/+ KrasG12D/+). N-WASP expression in human colorectal cancer was assessed using immunohistochemical staining of two tissue microarrays. Low levels of N-WASP expression were found to be associated with presence of MMR deficiency. There was no statistically significant difference in overall or cancer specific survival based on N-WASP expression. Collectively, the data presented here suggest a previously unreported role for N-WASP in regulation of intestinal epithelial differentiation and indicate that it may act as a tumour suppressor against development of benign precursor lesions of colorectal cancer. Further research is warranted to delineate the mechanisms underlying these processes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Introducción: Entre las diferentes herramientas clínicas para evaluar la presencia de enfermedad coronaria mediante puntajes, la más usada es la Escala de Riesgo cardiovascular de Framingham. Desde hace unos años, se creó el puntaje de calcio coronario el cual mide el riesgo cardiovascular según la presencia de placas ateromatosas vistas por tomografía computarizada. Se evaluó la asociación entre la escala de Framigham y el puntaje de calcio coronario en una población de sujetos sanos asintomáticos. Metodología: Se realizó un estudio transversal para evaluar la asociación entre el puntaje de calcio coronario y la escala de Framingham en sujetos asintomáticos que se practicaron exámen médico preventivo en la Fundación Cardioinfantil- Instituto de Cardiología (FCI-IC) en el periodo comprendido entre 1 de Julio 2011 hasta el 31 de octubre de 2015. Resultados: Se evaluaron 262 pacientes en total. La prevalencia de riesgo cardiovascular fue bajo en un 77.86% de la población, medio en 18.70% y alto en 3.44%, según la escala de Framingham. El riesgo cardiovascular según el puntaje de Calcio coronario fue nulo 70.99%, bajo en 21.75%, medio en 4.19%, severo en 3.05%. Se encontró una asociación entre ambos puntajes para riesgo estadísticamente significativa (p0,00001) Discusión: El riesgo cardiovascular establecido por escala de Framingham se relaciona de forma significativa con la presencia de placas aterioscleróticas. El estudio demostró que en una muestra de sujetos asintomáticos, hay una alteración estructural coronaria temprana.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Several studies have shown epidemiologic, clinical, immune-histochemical and molecular differences among esophageal adenocarcinomas (EAC). Since pathogenesis and biology of this tumor are far to be well defined, our study aimed to examine intra- and inter-tumor heterogeneity and to solve crucial controversies through different molecular approaches. Target sequencing was performed for sorted cancer subpopulations from formalin embedded material obtained from 38 EACs, not treated with neoadjuvant therapy. 35 out 38 cases carried at least one somatic mutation, not present in the corresponding sorted stromal cells. 73.7% of cases carried mutations in TP53 and 10.5% in CDKN2A. Mutations in other genes occurred at lower frequency, including HNF1A, not previously associated with EAC. Sorting allowed us to isolate clones with different mutational loads and/or additional copy number amplifications, confirming the high intra-tumor heterogeneity of these cancers. In our cohort TP53 gene abnormalities correlated with a better survival (P = 0.028); conversely, loss of SMAD4 protein expression was associated with a higher recurrence rate (P = 0.015). Shifting the focus on the epigenetic characterization of EAC, miR-221 and miR-483-3p resulted upregulated from the MicroRNA Array card analysis and confirmed with further testing. The up-regulation of both miRNAs correlated with clinical outcomes, in particular with a reduced cancer-specific survival (miR483-3p P=0.0293; miR221 P=0.0059). In vitro analyses demonstrated an increase for miR-483-3p (fold-change=2.7) that appear to be inversely correlated with SMAD4 expression in FLO-1 cell-line. In conclusion, selective sorting allowed to define the real mutation status and to isolate different cancer subclones. MiRNA expression analysis revealed a significant up-regulation of miR-221 and miR-483-3p, which correlated with worst prognosis, implying that they can be considered oncogenic factors in EAC. Therefore, cell sorting technologies, coupled with next generation sequencing, and the analysis of microRNA profiles seem to be promising strategies to guide treatment and help classify cancer prognosis.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

INTRODUCTION: Esophageal adenocarcinoma (EAC) is a severe malignancy in terms of prognosis and mortality rate. Because its great genetic heterogeneity, disputes regarding classification, prevention and treatments are still unsolved. AIM: We investigated intra- and inter-EAC heterogeneity by defining EAC’s somatic mutational profile and the role of candidate microRNAs, to correlate the molecular profile of tumors to clinical outcomes and to identify biomarkers for classification. METHODS: 38 EAC cases were analyzed via high-throughput cell sorting technology combined with targeted sequencing and whole genome low-pass sequencing. Targeted sequencing of further 169 cases was performed to widen the study. miR221 and miR483-3p expression was profiled via qPCR in 112 EACs and correlation with clinical outcomes was investigated. RESULTS: 35/38 EACs carried at least one somatic mutation absent in stromal cells. TP53 was found mutated in 73.7% of cases. Selective sorting revealed tumor subclones with different mutational loads and copy number alterations, confirming the high intra-tumor heterogeneity of EAC. Mutations were in most cases at homozygous state, and we identified alterations that were missed with the whole-tumor analysis. Mutations in HNF1A gene, not previously associated with EAC, were identified in both cohorts. Higher expression of miR483-3p and miR221 was associated with poorer cancer specific survival (P=0.0293 and P=0.0059), and recurrence in the Lauren intestinal subtype (P=0.0459 and P=0.0002). Median expression levels of miRNAs were higher in patients with advanced tumor stages. The loss of SMAD4 immunoreactivity was significantly associated with poorer cancer specific survival and recurrence (P=0.0452; P=0.022 respectively). CONCLUSION: Combining selective sorting technology and next generation sequencing allowed to better define EAC inter- and intra-tumor heterogeneity. We identified HNF1A as a new mutated gene associated to EAC that could be involved in tumor progression and promising biomarkers such as SMAD4, miR221 and miR483-3p to identify patients at higher risk for more aggressive tumors.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Esophageal adenocarcinoma (EAC) is a severe cancer that has been on the rise in Western nations over the past few decades. It has a high mortality rate and the 5-year survival rate is only 35%–45%. EAC has been included in a group of tumors with one of the highest rates of copy number alterations (CNAs), somatic structural rearrangements, high mutation frequency, with different mutational signatures, and with epigenetic mechanisms. The vast heterogeneity of EAC mutations makes it challenging to comprehend the biology that underlies tumor onset and development, identify prognostic biomarkers, and define a molecular classification to stratify patients. The only way to resolve the current disagreements is through an exhaustive molecular analysis of EAC. We examined the genetic profile of 164 patients' esophageal adenocarcinoma samples (without chemo-radiotherapy). The included patients did not receive neoadjuvant therapies, which can change the genetic and molecular composition of the tumor. Using next-generation sequencing technologies (NGS) at high coverage, we examined a custom panel of 26 cancer-related genes. Over the entire cohort, 337 variants were found, with the TP53 gene showing the most frequent alteration (67.27%). Poorer cancer-specific survival was associated with missense mutations in the TP53 gene (Log Rank P=0.0197). We discovered HNF1alpha gene disruptive mutations in 7 cases that were also affected by other gene changes. We started to investigate its role in EAC cell lines by silencing HNF1alpha to mimic our EAC cohort and we use Seahorse technique to analyze its role in the metabolism in esophageal cell. No significant changes were found in transfected cell lines. We conclude by finding that a particular class of TP53 mutations (missense changes) adversely impacted cancer-specific survival in EAC. HNF1alpha, a new EAC-mutated gene, was found, but more research is required to fully understand its function as a tumor suppressor gene.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

beta-blockers, as class, improve cardiac function and survival in heart failure (HF). However, the molecular mechanisms underlying these beneficial effects remain elusive. In the present study, metoprolol and carvedilol were used in doses that display comparable heart rate reduction to assess their beneficial effects in a genetic model of sympathetic hyperactivity-induced HF (alpha(2A)/alpha(2C)-ARKO mice). Five month-old HF mice were randomly assigned to receive either saline, metoprolol or carvedilol for 8 weeks and age-matched wild-type mice (WT) were used as controls. HF mice displayed baseline tachycardia, systolic dysfunction evaluated by echocardiography, 50% mortality rate, increased cardiac myocyte width (50%) and ventricular fibrosis (3-fold) compared with WT. All these responses were significantly improved by both treatments. Cardiomyocytes from HF mice showed reduced peak [Ca(2+)](i) transient (13%) using confocal microscopy imaging. Interestingly, while metoprolol improved [Ca(2+)](i) transient, carvedilol had no effect on peak [Ca(2+)](i) transient but also increased [Ca(2+)] transient decay dynamics. We then examined the influence of carvedilol in cardiac oxidative stress as an alternative target to explain its beneficial effects. Indeed, HF mice showed 10-fold decrease in cardiac reduced/oxidized glutathione ratio compared with WT, which was significantly improved only by carvedilol treatment. Taken together, we provide direct evidence that the beneficial effects of metoprolol were mainly associated with improved cardiac Ca(2+) transients and the net balance of cardiac Ca(2+) handling proteins while carvedilol preferentially improved cardiac redox state. (C) 2008 Elsevier Inc. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Spinal muscular atrophy (SMA), the leading genetic cause of death in childhood, is an autosomal recessive neuromuscular disorder characterized by progressive muscle weakness, associated with deletions of the survival motor neuron (SMN) gene identified and mapped to chromosome 5q13. SMN is present in two highly homologous copies (SMN1 and SMN2). In the general population, normal individuals (noncarriers) have at least one telomeric (SMN1) copy, and 5% of them have no copies of SMN2. Approximately 95% of SMA patients carry homologous deletions of SMN1 exon(s) 7 (and 8). SMN1 and SMN2 exons 7 and 8 differ only by 1 bp each, and SMA diagnosis might be performed by single-strand conformational polymorphism, PCR amplification followed by restriction fragment length polymorphism (RFLP), multiple ligation-dependent probe amplification, or realtime PCR of SMNs exons 7 and 8. We developed a simpler and cost-effective method to detect SMN1 exon 7 deletion based on allele-specific amplification PCR.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Colorectal cancer is one of the most common malignancies and a leading cause of cancer death worldwide. Molecular markers may improve clinicopathologic staging and provide a basis to guide novel therapeutic strategies which target specific tumourassociated molecules according to individual tumour biology; however, so far, no ideal molecular marker has been found to predict disease progression. We tested Ki-67 proliferation marker in primary and lymph node metastasis of CRC. We observed a statistical significant difference between the positive rates of neoplastic cells positively stained byKi-67 in both sites, with remarkable increased number of Ki-67 positive cells in primary tumor cells compared to cancer cells that invaded lymph nodes. We can speculate that the metastatic CRC in lymph node can be more resistant to the drugs that target cellular division.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

During a diagnostic investigation in a 40-year-old male with pericardial effusion associated with hypothyroidism, cholesterol pericarditis was detected. We report a brief review on the etiopathogeny, clinical findings, and therapeutical possibilities of this entity.