An Immune Network Intrusion Detection System Utilising Correlation Context

Network Intrusion Detection Systems (NIDS) are computer systems which monitor a network with the aim of discerning malicious from benign activity on that network. While a wide range of approaches have met varying levels of success, most IDSs rely on having access to a database of known attack signatures which are written by security experts. Nowadays, in order to solve problems with false positive alerts, correlation algorithms are used to add additional structure to sequences of IDS alerts. However, such techniques are of no help in discovering novel attacks or variations of known attacks, something the human immune system (HIS) is capable of doing in its own specialised domain. This paper presents a novel immune algorithm for application to the IDS problem. The goal is to discover packets containing novel variations of attacks covered by an existing signature base.

'Cooperative Automated worm Response and Detection ImmuNe ALgorithm (CARDINAL) inspired by T-cell Immunity and Tolerance'

The role of T-cells within the immune system is to confirm and assess anomalous situations and then either respond to or tolerate the source of the effect. To illustrate how these mechanisms can be harnessed to solve real-world problems, we present the blueprint of a T-cell inspired algorithm for computer security worm detection. We show how the three central T-cell processes, namely T-cell maturation, differentiation and proliferation, naturally map into this domain and further illustrate how such an algorithm fits into a complete immune inspired computer security system and framework.

Identification and expression analysis of two Wnt4 genes in the spotted scat ( Scatophagus argus )

Background: WNT4 is a protein that plays a crucial role in ovarian differentiation and development in mammals, with a relatively well understood function in mammalian gonadal differentiation. The role of Wnt4 in teleost fish; however, remains unclear. In the present study, cDNAs of Wnt4a and Wnt4b were cloned and characterized in the spotted scat. The expression patterns of two Wnt4 genes in the gonads at different stages of development and in fish after treatment with 17α-methyltestosterone (MT) were investigated. Results: The tissue distribution showed that Wnt4a was expressed in various tissues, including the gonads, gills, spleen, brain, and fin. Interestingly, Wnt4b not only was expressed in the gills, brain, and spleen, but also was obviously expressed in the ovary. During gonad development, Wnt4a was highly expressed in the testis at stage I and Wnt4b was mainly expressed in the ovary at stages II–III. After MT treatment, the mRNA expression of Wnt4a increased significantly up to 40 d, and the transcript level of Wnt4b decreased at 20 d. Conclusions: These results suggest that Wnt4a may be involved in gonad development and plays a role in the process of spermatogonial proliferation. Our results also demonstrate that Wnt4b is not only expressed in the nervous system, but also in the ovary and it may be involved in ovary development of the spotted scat.

Extraction and detection of mycotoxins in medicinal and aromatic plants: a case study with Aloysia citrodora P.

Plants frequently suffer contaminations by toxigenic fungi, and their mycotoxins can be produced throughout growth, harvest, drying and storage periods. The objective of this work was to validate a method for detection of toxins in medicinal and aromatic plants, through a fast and highly sensitive method, optimizing the joint co-extraction of aflatoxins (AF: AFB1, AFB2, AFG1 and AFG2) and ochratoxin A (OTA) by using Aloysia citrodora P. (lemon verbena) as a case study. For optimization purposes, samples were spiked (n=3) with standard solutions of a mix of the four AFs and OTA at 10 ng/g for AFB1, AFG1 and OTA, and at 6 ng/g of AFB2 and AFG2. Several extraction procedures were tested: i) ultrasound-assisted extraction in sodium chloride and methanol/water (80:20, v/v) [(OTA+AFs)1]; ii) maceration in methanol/1% NaHCO3 (70:30, v/v) [(OTA+AFs)2]; iii) maceration in methanol/1% NaHCO3 (70:30, v/v) (OTA1); and iv) maceration in sodium chloride and methanol/water (80:20, v/v) (AF1). AF and OTA were purified using the mycotoxin-specific immunoaffinity columns AflaTest WB and OchraTest WB (VICAM), respectively. Separation was performed with a Merck Chromolith Performance C18 column (100 x 4.6 mm) by reverse-phase HPLC coupled to a fluorescence detector (FLD) and a photochemical derivatization system (for AF). The recoveries obtained from the spiked samples showed that the single-extraction methods (OTA1 and AF1) performed better than co-extraction methods. For in-house validation of the selected methods OTA1 and AF1, recovery and precision were determined (n=6). The recovery of OTA for method OTA1 was 81%, and intermediate precision (RSDint) was 1.1%. The recoveries of AFB1, AFB2, AFG1 and AFG2 ranged from 64% to 110% for method AF1, with RSDint lower than 5%. Methods OTA1 and AF1 showed precision and recoveries within the legislated values and were found to be suitable for the extraction of OTA and AF for the matrix under study.

An immune inspired Network Intrusion Detection System utilising correlation

Network Intrusion Detection Systems (NIDS) are computer systems which monitor a network with the aim of discerning malicious from benign activity on that network. While a wide range of approaches have met varying levels of success, most IDSs rely on having access to a database of known attack signatures which are written by security experts. Nowadays, in order to solve problems with false positive alerts, correlation algorithms are used to add additional structure to sequences of IDS alerts. However, such techniques are of no help in discovering novel attacks or variations of known attacks, something the human immune system (HIS) is capable of doing in its own specialised domain. This paper presents a novel immune algorithm for application to the IDS problem. The goal is to discover packets containing novel variations of attacks covered by an existing signature base.

A Fuzzy Decision Strategy for Topic Identification and Dynamic Selection of Language Models

International audience

Voices of nigerian women survivors of trafficking held in italian centres for identification and expulsion

Department of Equal Opportunities; Presidency of the Council of Ministries; Province of Rome (metropolitan area)

The identification and differentiation of the Candida parapsilosis complex species by polymerase chain reaction-restriction fragment length polymorphism of the internal transcribed spacer region of the rDNA

Currently, it is accepted that there are three species that were formerly grouped under Candida parapsilosis : C. parapsilosis sensu stricto, Candida orthopsilosis , and Candida metapsilosis . In fact, the antifungal susceptibility profiles and distinct virulence attributes demonstrate the differences in these nosocomial pathogens. An accurate, fast, and economical identification of fungal species has been the main goal in mycology. In the present study, we searched sequences that were available in the GenBank database in order to identify the complete sequence for the internal transcribed spacer (ITS)1-5.8S-ITS2 region, which is comprised of the forward and reverse primers ITS1 and ITS4. Subsequently, an in silico polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed to differentiate the C. parapsilosis complex species. Ninety-eight clinical isolates from patients with fungaemia were submitted for analysis, where 59 isolates were identified as C. parapsilosis sensu stricto, 37 were identified as C. orthopsilosis, and two were identified as C. metapsilosis. PCR-RFLP quickly and accurately identified C. parapsilosis complex species, making this method an alternative and routine identification system for use in clinical mycology laboratories.

MILITARY VEHICLE OPTIMIZATION AND CONTROL

It is remarkable that there are no deployed military hybrid vehicles since battlefield fuel is approximately 100 times the cost of civilian fuel. In the commercial marketplace, where fuel prices are much lower, electric hybrid vehicles have become increasingly common due to their increased fuel efficiency and the associated operating cost benefit. An absence of military hybrid vehicles is not due to a lack of investment in research and development, but rather because applying hybrid vehicle architectures to a military application has unique challenges. These challenges include inconsistent duty cycles for propulsion requirements and the absence of methods to look at vehicle energy in a holistic sense. This dissertation provides a remedy to these challenges by presenting a method to quantify the benefits of a military hybrid vehicle by regarding that vehicle as a microgrid. This innovative concept allowed for the creation of an expandable multiple input numerical optimization method that was implemented for both real-time control and system design optimization. An example of each of these implementations was presented. Optimization in the loop using this new method was compared to a traditional closed loop control system and proved to be more fuel efficient. System design optimization using this method successfully illustrated battery size optimization by iterating through various electric duty cycles. By utilizing this new multiple input numerical optimization method, a holistic view of duty cycle synthesis, vehicle energy use, and vehicle design optimization can be achieved.

Improved Dynamic Headspace Sampling and Detection using Capillary Microextraction of Volatiles Coupled to Gas Chromatography Mass Spectrometry

Sampling and preconcentration techniques play a critical role in headspace analysis in analytical chemistry. My dissertation presents a novel sampling design, capillary microextraction of volatiles (CMV), that improves the preconcentration of volatiles and semivolatiles in a headspace with high throughput, near quantitative analysis, high recovery and unambiguous identification of compounds when coupled to mass spectrometry. The CMV devices use sol-gel polydimethylsiloxane (PDMS) coated microglass fibers as the sampling/preconcentration sorbent when these fibers are stacked into open-ended capillary tubes. The design allows for dynamic headspace sampling by connecting the device to a hand-held vacuum pump. The inexpensive device can be fitted into a thermal desorption probe for thermal desorption of the extracted volatile compounds into a gas chromatography-mass spectrometer (GC-MS). The performance of the CMV devices was compared with two other existing preconcentration techniques, solid phase microextraction (SPME) and planar solid phase microextraction (PSPME). Compared to SPME fibers, the CMV devices have an improved surface area and phase volume of 5000 times and 80 times, respectively. One (1) minute dynamic CMV air sampling resulted in similar performance as a 30 min static extraction using a SPME fiber. The PSPME devices have been fashioned to easily interface with ion mobility spectrometers (IMS) for explosives or drugs detection. The CMV devices are shown to offer dynamic sampling and can now be coupled to COTS GC-MS instruments. Several compound classes representing explosives have been analyzed with minimum breakthrough even after a 60 min. sampling time. The extracted volatile compounds were retained in the CMV devices when preserved in aluminum foils after sampling. Finally, the CMV sampling device were used for several different headspace profiling applications which involved sampling a shipping facility, six illicit drugs, seven military explosives and eighteen different bacteria strains. Successful detection of the target analytes at ng levels of the target signature volatile compounds in these applications suggests that the CMV devices can provide high throughput qualitative and quantitative analysis with high recovery and unambiguous identification of analytes.

Identification and characterization of parasitism genes from the pinewood nematode Bursaphelenchus xylophilus reveals a multilayered detoxification strategy.

The migratory endoparasitic nematode Bursaphelenchus xylophilus, which is the causal agent of pine wilt disease, has phytophagous and mycetophagous phases during its life cycle. This highly unusual feature distinguishes it from other plantparasitic nematodes and requires profound changes in biology between modes. During the phytophagous stage, the nematode migrates within pine trees, feeding on the contents of parenchymal cells. Like other plant pathogens, B. xylophilus secretes effectors from pharyngeal gland cells into the host during infection.We provide the first description of changes in the morphology of these gland cells between juvenile and adult life stages. Using a comparative transcriptomics approach and an effector identification pipeline, we identify numerous novel parasitism genes which may be important for the mediation of interactions of B. xylophilus with its host. In-depth characterization of all parasitism genes using in situ hybridization reveals two major categories of detoxification proteins, those specifically expressed in either the pharyngeal gland cells or the digestive system. These data suggest that B. xylophilus incorporates effectors in a multilayer detoxification strategy in order to protect itself from host defence responses during phytophagy.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Fracionamento dos carboidratos pelas equações do Cornell Net Carbohydrate and Protein System de três cultivares de girassol na presença ou não de irrigação

Objetivou-se quantificar as frações de carboidratos pelas equações do Cornell Net Carbohydrate and Protein System (CNCPS) de três cultivares de girassol (Helianthus annuus L.) cultivados na presença ou não de irrigação. A utilização de uma preparação fibrosa, denominada parede celular (PC), nas equações da CNCPS, em substituição à fibra em detergente neutro (FDN) não promoveu diferenças nas frações de carboidratos B1 e C, mas influenciou as frações A e B2. Como os valores da fração B1, obtidos pelo modelo CNCPS foram menores que os teores de amido e pectina determinados em laboratório, supõe-se que a pectina e outros oligossacarídeos da parede celular, solubilizados pela solução de detergente neutro (fibra solúvel), nunca fizeram parte da fração B1, e sim da fração A. Apesar de os carboidratos da fibra solúvel apresentarem elevadas taxas de degradação, não parece adequada a caracterização da fibra solúvel na fração A. Parece mais adequado que a fibra solúvel (que inclui a pectina) seja alocada a uma fração exclusivamente sua, que pode ser a fração B2, e que seja criada uma nova fração, a B3, para os carboidratos digeríveis da parede celular. Assim, a fração B1 seria composta apenas de amido. A equação da fração C, que estima os carboidratos indigeríveis da parede celular, pode ser simplificada, relacionando a fração indigerível ao teor de lignina na matéria seca, e não à FDN isenta de cinzas e proteína, como atualmente utilizado. Esta proposta tem implicações práticas, uma vez que a fração indigerível da parede celular tem sido expressa em relação à FDN, e não na MS, com base no fato de que os efeitos inibitórios da lignina ocorrem sobre os componentes fibrosos da parede celular vegetal, e não sobre o conteúdo celular.

EVOLUTION OF FLORAL MORPHOLOGY AND POLLINATION SYSTEM IN BIGNONIEAE (BIGNONIACEAE)

The radiation of angiosperms is associated with shifts among pollination modes that are thought to have driven the diversification of floral forms. However, the exact sequence of evolutionary events that led to such great diversity in floral traits is unknown for most plant groups. Here, we characterize the patterns of evolution of individual floral traits and overall floral morphologies in the tribe Bignonieae (Bignoniaceae). We identified 12 discrete traits that are associated with seven floral types previously described for the group and used a penalized likelihood tree of the tribe to reconstruct the ancestral states of those traits at all nodes of the phylogeny of Bignonieae. In addition, evolutionary correlations among traits were conducted using a maximum likelihood approach to test whether the evolution of individual floral traits followed the correlated patterns of evolution expected under the ""pollination syndrome"" concept. The ancestral Bignonieae flower presented an Anemopaegma-type morphology, which was followed by several parallel shifts in floral morphologies. Those shifts occurred through intermediate stages resulting in mixed floral morphologies as well as directly from the Anemopaegma-type morphology to other floral types. Positive and negative evolutionary correlations among traits fit patterns expected under the pollination syndrome perspective, suggesting that interactions between Bignonieae flowers and pollinators likely played important roles in the diversification of the group as a whole.

Identification and Phylogenetic Analysis of Heme Synthesis Genes in Trypanosomatids and Their Bacterial Endosymbionts

It has been known for decades that some insect-infecting trypanosomatids can survive in culture without heme supplementation while others cannot, and that this capability is associated with the presence of a betaproteobacterial endosymbiont in the flagellate's cytoplasm. However, the specific mechanisms involved in this process remained obscure. In this work, we sequence and phylogenetically analyze the heme pathway genes from the symbionts and from their hosts, as well as from a number of heme synthesis-deficient Kinetoplastida. Our results show that the enzymes responsible for synthesis of heme are encoded on the symbiont genomes and produced in close cooperation with the flagellate host. Our evidence suggests that this synergistic relationship is the end result of a history of extensive gene loss and multiple lateral gene transfer events in different branches of the phylogeny of the Trypanosomatidae.