Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

National Institutes Of Health Consensus Development Project On Criteria For Clinical Trials In Chronic Graft-versus-host Disease: I. The 2014 Diagnosis And Staging Working Group Report.

The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.

Laser Printer Attribution: Exploring New Features And Beyond.

With a huge amount of printed documents nowadays, identifying their source is useful for criminal investigations and also to authenticate digital copies of a document. In this paper, we propose novel techniques for laser printer attribution. Our solutions do not need very high resolution scanning of the investigated document and explore the multidirectional, multiscale and low-level gradient texture patterns yielded by printing devices. The main contributions of this work are: (1) the description of printed areas using multidirectional and multiscale co-occurring texture patterns; (2) description of texture on low-level gradient areas by a convolution texture gradient filter that emphasizes textures in specific transition areas and (3) the analysis of printer patterns in segments of interest, which we call frames, instead of whole documents or only printed letters. We show by experiments in a well documented dataset that the proposed methods outperform techniques described in the literature and present near-perfect classification accuracy being very promising for deployment in real-world forensic investigations.

[consensus Of The Brazilian Society Of Rheumatology For The Diagnosis, Management And Treatment Of Lupus Nephritis].

To develop recommendations for the diagnosis, management and treatment of lupus nephritis in Brazil. Extensive literature review with a selection of papers based on the strength of scientific evidence and opinion of the Commission on Systemic Lupus Erythematosus members, Brazilian Society of Rheumatology. 1) Renal biopsy should be performed whenever possible and if this procedure is indicated; and, when the procedure is not possible, the treatment should be guided with the inference of histologic class. 2) Ideally, measures and precautions should be implemented before starting treatment, with emphasis on attention to the risk of infection. 3) Risks and benefits of treatment should be shared with the patient and his/her family. 4) The use of hydroxychloroquine (preferably) or chloroquine diphosphate is recommended for all patients (unless contraindicated) during induction and maintenance phases. 5) The evaluation of the effectiveness of treatment should be made with objective criteria of response (complete remission/partial remission/refractoriness). 6) ACE inhibitors and/or ARBs are recommended as antiproteinuric agents for all patients (unless contraindicated). 7) The identification of clinical and/or laboratory signs suggestive of proliferative or membranous glomerulonephritis should indicate an immediate implementation of specific therapy, including steroids and an immunosuppressive agent, even though histological confirmation is not possible. 8) Immunosuppressives must be used during at least 36 months, but these medications can be kept for longer periods. Its discontinuation should only be done when the patient achieve and maintain a sustained and complete remission. 9) Lupus nephritis should be considered as refractory when a full or partial remission is not achieved after 12 months of an appropriate treatment, when a new renal biopsy should be considered to assist in identifying the cause of refractoriness and in the therapeutic decision.

Digestive Peptidase Evolution In Holometabolous Insects Led To A Divergent Group Of Enzymes In Lepidoptera.

Trypsins and chymotrypsins are well-studied serine peptidases that cleave peptide bonds at the carboxyl side of basic and hydrophobic l-amino acids, respectively. These enzymes are largely responsible for the digestion of proteins. Three primary processes regulate the activity of these peptidases: secretion, precursor (zymogen) activation and substrate-binding site recognition. Here, we present a detailed phylogenetic analysis of trypsins and chymotrypsins in three orders of holometabolous insects and reveal divergent characteristics of Lepidoptera enzymes in comparison with those of Coleoptera and Diptera. In particular, trypsin subsite S1 was more hydrophilic in Lepidoptera than in Coleoptera and Diptera, whereas subsites S2-S4 were more hydrophobic, suggesting different substrate preferences. Furthermore, Lepidoptera displayed a lineage-specific trypsin group belonging only to the Noctuidae family. Evidence for facilitated trypsin auto-activation events were also observed in all the insect orders studied, with the characteristic zymogen activation motif complementary to the trypsin active site. In contrast, insect chymotrypsins did not seem to have a peculiar evolutionary history with respect to their mammal counterparts. Overall, our findings suggest that the need for fast digestion allowed holometabolous insects to evolve divergent groups of peptidases with high auto-activation rates, and highlight that the evolution of trypsins led to a most diverse group of enzymes in Lepidoptera.

Sorghum Flour Fractions: Correlations Among Polysaccharides, Phenolic Compounds, Antioxidant Activity And Glycemic Index.

Nutrients composition, phenolic compounds, antioxidant activity and estimated glycemic index (EGI) were evaluated in sorghum bran (SB) and decorticated sorghum flour (DSF), obtained by a rice-polisher, as well as whole sorghum flour (WSF). Correlation between EGI and the studied parameters were determined. SB presented the highest protein, lipid, ash, β-glucan, total and insoluble dietary fiber contents; and the lowest non-resistant and total starch contents. The highest carbohydrate and resistant starch contents were in DSF and WSF, respectively. Phenolic compounds and antioxidant activities were concentrated in SB. The EGI values were: DSF 84.5±0.41; WSF 77.2±0.33; and SB 60.3±0.78. Phenolic compounds, specific flavonoids and antioxidant activities, as well as total, insoluble and soluble dietary fiber and β-glucans of sorghum flour samples were all negatively correlated to EGI. RS content was not correlated to EGI.

The Geometric Curvature Of The Spine Of Runners During Maximal Incremental Effort Test.

This study sought to analyse the behaviour of the average spinal posture using a novel investigative procedure in a maximal incremental effort test performed on a treadmill. Spine motion was collected via stereo-photogrammetric analysis in thirteen amateur athletes. At each time percentage of the gait cycle, the reconstructed spine points were projected onto the sagittal and frontal planes of the trunk. On each plane, a polynomial was fitted to the data, and the two-dimensional geometric curvature along the longitudinal axis of the trunk was calculated to quantify the geometric shape of the spine. The average posture presented at the gait cycle defined the spine Neutral Curve. This method enabled the lateral deviations, lordosis, and kyphosis of the spine to be quantified noninvasively and in detail. The similarity between each two volunteers was a maximum of 19% on the sagittal plane and 13% on the frontal (p<0.01). The data collected in this study can be considered preliminary evidence that there are subject-specific characteristics in spinal curvatures during running. Changes induced by increases in speed were not sufficient for the Neutral Curve to lose its individual characteristics, instead behaving like a postural signature. The data showed the descriptive capability of a new method to analyse spinal postures during locomotion; however, additional studies, and with larger sample sizes, are necessary for extracting more general information from this novel methodology.

New Fefe-hydrogenase Genes Identified In A Metagenomic Fosmid Library From A Municipal Wastewater Treatment Plant As Revealed By High-throughput Sequencing.

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

Characterisation Of The Membrane Transport Of Pilocarpine In Cell Suspension Cultures Of Pilocarpus Microphyllus.

Pilocarpine is an alkaloid obtained from the leaves of Pilocarpus genus, with important pharmaceutical applications. Previous reports have investigated the production of pilocarpine by Pilocarpus microphyllus cell cultures and tried to establish the alkaloid biosynthetic route. However, the site of pilocarpine accumulation inside of the cell and its exchange to the medium culture is still unknown. Therefore, the aim of this study was to determine the intracellular accumulation of pilocarpine and characterise its transport across membranes in cell suspension cultures of P. microphyllus. Histochemical analysis and toxicity assays indicated that pilocarpine is most likely stored in the vacuoles probably to avoid cell toxicity. Assays with exogenous pilocarpine supplementation to the culture medium showed that the alkaloid is promptly uptaken but it is rapidly metabolised. Treatment with specific ABC protein transporter inhibitors and substances that disturb the activity of secondary active transporters suppressed pilocarpine uptake and release suggesting that both proteins may participate in the traffic of pilocarpine to inside and outside of the cells. As bafilomicin A1, a specific V-type ATPase inhibitor, had little effect and NH4Cl (induces membrane proton gradient dissipation) had moderate effect, while cyclosporin A and nifedipine (ABC proteins inhibitors) strongly inhibited the transport of pilocarpine, it is believed that ABC proteins play a major role in the alkaloid transport across membranes but it is not the exclusive one. Kinetic studies supported these results.

Influence Of The Major Nitrite Transporter Nirc On The Virulence Of A Swollen Head Syndrome Avian Pathogenic E. Coli (apec) Strain.

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Cota racial e estado: abolição do racismo ou direitos de raça?

The objective of this article is to examine the current government proposal of racialization in the Brazilian population, in order to offer support to affirmative action programs that meet the specific needs of those who classify themselves as black. Firstly we focused on the revival of the notion of race among scholars, politicians, and anti-racism activists, as well as on the difficulty in determining who is black in Brazil. Next we examined the racial quota system in the United States and its proclaimed success. Finally, we assessed the extent to which the introduction of racial quota in employment and university enrollment should be imposed as the sole political option for those intending to eliminate racism in Brazilian society.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Termo de consentimento livre e esclarecido aos usuários de clínicas odontológicas brasileiras: aspectos éticos e legais

O consentimento do paciente antes do início de qualquer procedimento é uma condição a ser respeitada pelos profissionais da odontologia, sem nenhuma exceção. É necessário que o paciente esteja ciente de seu status de saúde, de suas necessidades específicas, do propósito de cada tratamento, conheça os planejamentos alternativos (incluindo o não tratamento), saiba do seu prognóstico, riscos, consequências, limitações e se conscientize das suas responsabilidades e as do seu cirurgião-dentista, proporcionando o sucesso do tratamento. O termo de consentimento livre e esclarecido (TCLE) visa fortalecer e esclarecer a posição do paciente, estabelecendo os direitos e deveres de ambas as partes paciente e profissional. O conhecimento integral do tratamento diminuirá a ansiedade do paciente e as complicações de tratamento, promoverá maior qualidade dos serviços odontológicos e maior satisfação do dentista e do paciente. Entretanto, no Brasil, poucos artigos são encontrados e existem alguns problemas éticos envolvendo as clínicas odontológicas, no que diz respeito a este documento de esclarecimento para o paciente. Diante disso, este trabalho tem por objetivo realizar uma revisão crítica sobre o tema abordado, demonstrando a importância do TCLE na clínica odontológica brasileira e na vida profissional dos cirurgiões-dentistas.

Infectious endocarditis caused by Nocardia sp.: histological morphology as a guide for the specific diagnosis

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Biotin-avidin sandwich elisa with specific human isotypes IgG1 and IgG4 for Culicidae mosquito blood meal identification from an epizootic yellow fever area in Brazil

With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.