Beneficial effect of recombinant human growth hormone on the intestinal mucosa barrier of septic rats

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Tumor necrosis factor alpha increases epithelial barrier permeability by disrupting tight junctions in Caco-2 cells

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Functionalisation of spruce O-acetyl-galactoglucomannans for barrier and composite applications

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.

Compte rendu des maladies observées et des opérations pratiquées à l'Hôtel-Dieu de Lyon pendant l'année 1850, dans le service de M. Barrier,...

Comprend : Réflexions

The importance of the Hedgehog signaling pathway at the level of the blood-brain barrier

La barrière hémato-encéphalique (BHE) protège le système nerveux central (SNC) en contrôlant le passage des substances sanguines et des cellules immunitaires. La BHE est formée de cellules endothéliales liées ensemble par des jonctions serrées et ses fonctions sont maintenues par des astrocytes, celles ci sécrétant un nombre de facteurs essentiels. Une analyse protéomique de radeaux lipidiques de cellules endothéliales de la BHE humaine a identifié la présence de la voie de signalisation Hedgehog (Hh), une voie souvent liées à des processus de développement embryologique ainsi qu’au niveau des tissus adultes. Suite à nos expériences, j’ai déterminé que les astrocytes produisent et secrètent le ligand Sonic Hh (Shh) et que les cellules endothéliales humaines en cultures primaires expriment le récepteur Patched (Ptch)-1, le co-récepteur Smoothened (Smo) et le facteur de transcription Gli-1. De plus, l’activation de la voie Hh augmente l’étanchéité des cellules endothéliales de la BHE in vitro. Le blocage de l’activation de la voie Hh en utilisant l’antagoniste cyclopamine ainsi qu’en utilisant des souris Shh déficientes (-/-) diminue l’expression des protéines de jonctions serrées, claudin-5, occcludin, et ZO-1. La voie de signalisation s’est aussi montrée comme étant immunomodulatoire, puisque l’activation de la voie dans les cellules endothéliales de la BHE diminue l’expression de surface des molécules d’adhésion ICAM-1 et VCAM-1, ainsi que la sécrétion des chimiokines pro-inflammatoires IL-8/CXCL8 et MCP-1/CCL2, créant une diminution de la migration des lymphocytes CD4+ à travers une monocouche de cellules endothéliales de la BHE. Des traitements avec des cytokines pro-inflammatoires TNF-α and IFN-γ in vitro, augmente la production de Shh par les astrocytes ainsi que l’expression de surface de Ptch-1 et de Smo. Dans des lésions actives de la sclérose en plaques (SEP), où la BHE est plus perméable, les astrocytes hypertrophiques augmentent leur expression de Shh. Par contre, les cellules endothéliales de la BHE n’augmentent pas leur expression de Ptch-1 ou Smo, suggérant une dysfonction dans la voie de signalisation Hh. Ces résultats montrent que la voie de signalisation Hh promeut les propriétés de la BHE, et qu’un environnement d’inflammation pourrait potentiellement dérégler la BHE en affectant la voie de signalisation Hh des cellules endothéliales.

Survival of multi-drug resistant enteropathogenic Escherichia coli and Salmonella paratyphi in Vembanadu lake as a function of saltwater barrier along southwest coast of India

The objective of the study was to evaluate the survival response of multi-drug resistant enteropathogenic Escherichia coli and Salmonella paratyphi to the salinity fluctuations induced by a saltwater barrier constructed in Vembanadu lake, which separates the lake into a freshwater dominated southern and brackish water dominated northern part. Therefore, microcosms containing freshwater, brackish water and microcosms with different saline concentrations (5, 10, 15, 20, 25 ppt) inoculated with E. coli/S. paratyphi were monitored up to 34 days at 20 and 30 WC. E. coli and S. paratyphi exhibited significantly higher (p <0.05) survival at 20 WC compared to 30 WC in all microcosms. Despite fresh/brackish water, E. coli and S. paratyphi showed prolonged survival up to 34 days at both temperatures. They also demonstrated better survival potential at all tested saline concentrations except 25 ppt where a significantly higher (p<0.0001) decay was observed. Therefore, enhanced survival exhibited by the multi-drug resistant enteropathogenic E. coli and S. paratyphi over a wide range of salinity levels suggest that they are able to remain viable for a very long time at higher densities in all seasons of the year in Vembanadu lake irrespective of saline concentrations, and may pose potential public health risks during recreational activities

Room-temperature continuous-wave operation of GaInNAs/GaAs quantum dot laser with GaAsN barrier grown by solid source molecular beam epitaxy

We present the results of GaInNAs/GaAs quantum dot structures with GaAsN barrier layers grown by solid source molecular beam epitaxy. Extension of the emission wavelength of GaInNAs quantum dots by ~170nm was observed in samples with GaAsN barriers in place of GaAs. However, optimization of the GaAsN barrier layer thickness is necessary to avoid degradation in luminescence intensity and structural property of the GaInNAs dots. Lasers with GaInNAs quantum dots as active layer were fabricated and room-temperature continuous-wave lasing was observed for the first time. Lasing occurs via the ground state at ~1.2μm, with threshold current density of 2.1kA/cm[superscript 2] and maximum output power of 16mW. These results are significantly better than previously reported values for this quantum-dot system.

User Experience (a hidden barrier) in OER

More Open Education Resources (OER) and learning environments are being created and starting to mature and there are a number of barriers to learning and creator participation. One often overlooked barrier that has been given less attention, especially within OERs, is user experience (UX). UX is the way a person feels about using a product, system or service. We are creatures with emotional needs and, in the rush to get great content open and available sometimes the usability, the wow factor and good design principles get left by the wayside. I will demonstrate ways to think about UX for your OER and learning environments and why this is an important factor in helping engage learners with our educational materials. ‘The real payoff comes when we can make that remarkability last. When we can make people continually feel our work is worthy of discussion. When—for weeks, months, maybe even years— the people who engage with our work continue to sing its praises to everybody they meet’– (Jared Spool in Walter, A. Designing for Emotion). Walter, A. (2011) Designing for Emotion, A Book Apart. http://www.abookapart.com/products/designing-for-emotion