A Generic Model of Execution for Synthesizing Domain-Specific Models

Software engineering researchers are challenged to provide increasingly more pow- erful levels of abstractions to address the rising complexity inherent in software solu- tions. One new development paradigm that places models as abstraction at the fore- front of the development process is Model-Driven Software Development (MDSD). MDSD considers models as first class artifacts, extending the capability for engineers to use concepts from the problem domain of discourse to specify apropos solutions. A key component in MDSD is domain-specific modeling languages (DSMLs) which are languages with focused expressiveness, targeting a specific taxonomy of problems. The de facto approach used is to first transform DSML models to an intermediate artifact in a HLL e.g., Java or C++, then execute that resulting code. Our research group has developed a class of DSMLs, referred to as interpreted DSMLs (i-DSMLs), where models are directly interpreted by a specialized execution engine with semantics based on model changes at runtime. This execution engine uses a layered architecture and is referred to as a domain-specific virtual machine (DSVM). As the domain-specific model being executed descends the layers of the DSVM the semantic gap between the user-defined model and the services being provided by the underlying infrastructure is closed. The focus of this research is the synthesis engine, the layer in the DSVM which transforms i-DSML models into executable scripts for the next lower layer to process. The appeal of an i-DSML is constrained as it possesses unique semantics contained within the DSVM. Existing DSVMs for i-DSMLs exhibit tight coupling between the implicit model of execution and the semantics of the domain, making it difficult to develop DSVMs for new i-DSMLs without a significant investment in resources. At the onset of this research only one i-DSML had been created for the user- centric communication domain using the aforementioned approach. This i-DSML is the Communication Modeling Language (CML) and its DSVM is the Communication Virtual machine (CVM). A major problem with the CVM’s synthesis engine is that the domain-specific knowledge (DSK) and the model of execution (MoE) are tightly interwoven consequently subsequent DSVMs would need to be developed from inception with no reuse of expertise. This dissertation investigates how to decouple the DSK from the MoE and sub- sequently producing a generic model of execution (GMoE) from the remaining appli- cation logic. This GMoE can be reused to instantiate synthesis engines for DSVMs in other domains. The generalized approach to developing the model synthesis com- ponent of i-DSML interpreters utilizes a reusable framework loosely coupled to DSK as swappable framework extensions. This approach involves first creating an i-DSML and its DSVM for a second do- main, demand-side smartgrid, or microgrid energy management, and designing the synthesis engine so that the DSK and MoE are easily decoupled. To validate the utility of the approach, the SEs are instantiated using the GMoE and DSKs of the two aforementioned domains and an empirical study to support our claim of reduced developmental effort is performed.

Specific humoral response of hosts with variable schistosomiasis susceptibility

The schistosome blood flukes are some of the largest global causes of parasitic morbidity. Further study of the specific antibody response during schistosomiasis may yield the vaccines and diagnostics needed to combat this disease. Therefore, for the purposes of antigen discovery, sera and antibody-secreting cell (ASC) probes from semi-permissive rats and sera from susceptible mice were used to screen a schistosome protein microarray. Following Schistosoma japonicum infection, rats had reduced pathology, increased antibody responses and broader antigen recognition profiles compared with mice. With successive infections, rat global serological reactivity and the number of recognized antigens increased. The local antibody response in rat skin and lung, measured with ASC probes, increased after parasite migration and contributed antigen-specific antibodies to the multivalent serological response. In addition, the temporal variation of anti-parasite serum antibodies after infection and reinfection followed patterns that appear related to the antigen driving the response. Among the 29 antigens differentially recognized by the infected hosts were numerous known vaccine candidates, drug targets and several S. japonicum homologs of human schistosomiasis resistance markers-the tegument allergen-like proteins. From this set, we prioritized eight proteins that may prove to be novel schistosome vaccine and diagnostic antigens.

A comparative study of translation strategies applied in dealing with role languages. : A translation analysis of the video game Final Fantasy XIV

Localisation is the process of taking a product and adapting it to fit the culture in question. This usually involves making it both linguistically and culturally appropriate for the target audience. While there are many areas in video game translations where localisation holds a factor, this study will focus on localisation changes in the personalities of fictional characters between the original Japanese version and the English localised version of the video game Final Fantasy XIV: A Realm Reborn and its expansion Heavensward for PC, PS3 and PS4. With this in mind, specific examples are examined using Satoshi Kinsui's work on yakuwarigo, role language as the main framework for this study. Five non-playable characters were profiled and had each of their dialogues transcribed for a comparative analysis. This included the original Japanese text, the officially localised English text and a translation of the original Japanese text done by myself. Each character were also given a short summary and a reasoned speculation on why these localisation changes might have occurred. The result shows that there were instances where some translations had been deliberately adjusted to ensure that the content did not cause any problematic issues to players overseas. This could be reasoned out that some of the Japanese role languages displayed by characters in this game could potentially cause dispute among the western audience. In conclusion, the study shows that localisation can be a difficult process that not only requires a translator's knowledge of the source and target language, but also display some creativity in writing ability to ensure that players will have a comparable experience without causing a rift in the fanbase.

American or British English? : Attitudes towards English dialects among Swedish pupils

The two major varieties of English are American and British English. In Swedish compulsory school both varieties are taught. This essay examines the preferences and attitudes of pupils in 9th grades towards the two varieties, and if there are any gender differences. Previous research has shown that pupils are becoming more and more positive towards American English than they have been in earlier studies. This essay is based on a quantitative study carried out through questionnaires handed-out to 84 9th graders. The results show that the pupils prefer American English in speaking and for educational purposes. However, British English is viewed as more intelligent, professional, beautiful and correct. These findings mostly correspond to previous research but also show some contrasting features such as pupils wanting to speak British English rather than American English.

Single nucleotide polymorphisms in the IS900 sequence of Mycobacterium avium subsp. paratuberculosis are strain type specific

Insertion sequence IS900 is used as a target for the identification of Mycobacterium avium subsp. paratuberculosis. Previous reports have revealed single nucleotide polymorphisms within IS900. This study, which analyzed the IS900 sequences of a panel of isolates representing M. avium subsp. paratuberculosis strain types I, II, and III, revealed conserved type-specific polymorphisms that could be utilized as a tool for diagnostic and epidemiological purposes.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Spectrophotometric Evaluation Of Dental Bleaching Under Orthodontic Bracket In Enamel And Dentin.

Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

A lingüística indígena no Brasil

This article presents a panorama of the area of the linguistics of the indigenous languages in Brazil within the discipline of Brazilian linguiistics as a whole. Special attention is given to those aspects related to its specific development. It is argued that in contrast to what is commonly supposed, the arrival of the Summer Institute of Linguistics (1959) not only was not the beginning of this area of study in the country, but it even contributed to the delay in its establishment. It was only after the return of Brazilian scholars educated abroad who were interested in the study of the national indigenous languages that a specialized branch of linguistics directed to the study of these languages began to take form. The present situation of the area and perspectives for future development are both explored.

Resonancias discursivas y cortesía en prácticas de lecto-escritura

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O uso de dicas especificas como estrategia de atenção seletiva em portadores da Sindrome de Down

Universidade Estadual de Campinas. Faculdade de Educação Física

Modelo de análise técnico-tática do jogo de handebol : necessidades, perspectivas e implicações de um modelo de interpretação das situações de jogo em tempo real

Universidade Estadual de Campinas . Faculdade de Educação Física

Fatores de stress em jogadores de futebol profissional

Universidade Estadual de Campinas . Faculdade de Educação Física