Plano de ação na prevenção e controle da obesidade na Estratégia da Saúde da Família na zona rural II do município de Itajubá-MG

A obesidade é uma doença crônica caracterizada pelo acúmulo excessivo de tecido adiposo no organismo. Sua prevalência cresceu acentuadamente nas últimas décadas, principalmente nos países em desenvolvimento. Sua causa é multifatorial e depende da interação de fatores genéticos, metabólicos, sociais, comportamentais e culturais. No Brasil, segundo dados da Pesquisa Nacional em Saúde e Nutrição (PNSN), cerca de 27% dos homens e 38% das mulheres apresentam sobrepeso ou obesidade. A Estratégia da Saúde da Família da Zona Rural II, localizada no município de Itajubá, sul de Minas Gerais, possui uma população adstrita de 2.013 habitantes, constituída por 608 famílias cadastradas. Após a análise situacional realizada juntamente com a equipe, por meio da estimativa rápida, observamos que um dos problemas de maior prioridade é as doenças crônicas cardiovasculares e endocrinológicas, que por sua vez, podem resultar em consequências em vários outros sistemas orgânicos. Devido a alta prevalência da obesidade na população em estudo (cerca de 35%), essa foi definida como o principal problema, pois a obesidade tornou-se problema de saúde pública, uma vez que as consequências para a saúde são muitas e variam do risco aumentado de morte prematura a graves doenças não letais, mas debilitantes, que afetam diretamente a qualidade de vida

Plano de intervenção para controle de hipertensão arterial da população assistida pela equipe de Saúde da Família da UBS Luiz Vieira Timoteo em Campo Alegre-Al

A Hipertensão Arterial Sistêmica (HAS) é uma doença comum em todo o mundo e acomete jovens, adultos e idosos, pessoas de ambos os sexos, de todas as raças e de qualquer padrão social;é uma condição clínica multifatorial caracterizada por níveis elevados e sustentados de pressão arterial (PA). Associa-se freqüentemente a alterações funcionais e/ou estruturais dos órgãos-alvo (coração, encéfalo, rins e vasos sanguíneos) e a alterações metabólicas, com conseqüente aumento do risco de eventos cardiovasculares fatais e não-fatais; os fatores de risco tais como obesidade, sedentarismo, hábitos inadequados de alimentação, baixos níveis de escolaridade e analfabetismo, causam aumento e manutenção dos casos de Hipertensão Arterial, além da não adesão ao tratamento. Este trabalho teve como objetivo elaborar um plano de intervenção para aumentar a adesão ao tratamento de hipertensão arterial sistêmica de pacientes com HAS assistidos pela equipe de saúde da família na UBS Luis Vieira Timóteo de Campo Alegre/AL. O primeiro passo foi levantar os principais problemas vivenciados pela população, utilizando o diagnóstico Situacional como ferramenta para viabilizar essa etapa do processo. As informações do diagnóstico situacional foram obtidas por meio do método de Estimativa Rápida, no qual foi possível detectar os principais problemas de saúde e as formas de atuação sobre eles, identificar os atores envolvidos, a viabilidade política, os recursos necessários e os meios a serem utilizados para que o objetivo pudesse ser alcançado. Para embasar toda construção do projeto foi elaborada uma revisão narrativa da literatura cujas fontes foram: documentos do Ministério da saúde publicados em sites oficiais, periódicos indexados na Biblioteca Virtual em Saúde (BVS), na base de dados Scientific Eletronic Library Online (SciELO) e sites da OMS e IBGE. Foram utilizados como descritores:hipertensão arterial, fatores de riscos, saúde da família e atenção primária á saúde. O recorte temporal dos artigos selecionados foi entre os anos de 2005 e 2016. Foram propostas intervenções que possam impactar na redução da incidência da HAS,além de minimizar os possíveis fatores de riscos implicados na piora da evolução da HAS. Para o desenvolvimento do Plano de Intervenção foi utilizado o Método do Planejamento Estratégico Situacional (PES). Concluiu-se que a maioria dos pacientes assistidos pela equipe da área de abrangência da UBS Luiz Vieira Timóteo tem hábitos alimentícios inadequados, e que alguns moram sozinhos, favorecendo o não cumprimento do tratamento conforme proposto. Neste sentido, ficou evidenciada a necessidade urgente de intervenção no atendimento dos pacientes hipertensos para que haja de fato um controle da situação da hipertensão arterial sistêmica na área assistida pela equipe

Qualidade de vida em epilepsia e percepção de controle de crises

The individual affective-cognitive evaluations are important factors that control the way he feels the disease impact in his life. Then, the perception of seizure control is a more important factor to evaluate Quality of Life (QoL) than the illness characteristics, such as the severity, type, sickening period and seizure frequency. This study searched for the relationship among the subjective variables (perception of seizure control) and the illness characteristics to evaluate QoL. The sample consisted of 60 individuals with chronic epilepsy, aging 18 to 70 (M=37.05; SD=11.25), chosen at randon from the ambulatory of epilepsy - HC/UNICAMP, by the Questionnaire 65. The illness characteristics were not significant, except the seizures frequency, when associated to the impairment in QoL among controlled seizures and seizures with frequency higher than 10 per month (p=0.021). The perception of control was significantly associated to QoL (p=0.005).

Aspectos técnicos da monitorização da pressão intracraniana pelo método subaracnóideo no traumatismo craniencefálico grave

Two hundred and six patients with severe head injury (Glasgow Coma Scale of 8 points or less after nonsurgical resuscitation on admission), managed at Intensive Care Unit-Hospital das Clínicas - Universidade Estadual de Campinas were prospectively analysed. All patients were assessed by CT scan and 72 required neurosurgical intervention. All patients were continuously monitored to evaluate intracranial pressure (ICP) levels by a subarachnoid device (11 with subarachnoid metallic bolts and 195 with subarachnoid polyvinyl catheters). The ICP levels were continuously observed in the bedside pressure monitor display and their end-hour values were recorded in a standard chart. The patients were managed according to a standard protocol guided by the ICP levels. There were no intracranial haemorrhagic complications or hematomas due the monitoring method. Sixty six patients were punctured by lateral C1-C2 technique to assess infectious complications and 2 had positive cerebrospinal fluid samples for Acinetobacter sp. The final results measured at hospital discharge showed 75 deaths (36,40%) and 131 (63,60%) survivors. ICP levels had significantly influenced the final results (p<0,001). The subarachnoid method to continuously assess the ICP levels was considered aplicable, safe, simple, low cost and useful to advise the management of the patients. The ICP record methodology was practical and useful. Despite the current technical advances the subarachnoid method was considered viable to assess the ICP levels in severe head injury.

Estilos motivacionais de professores: propriedades psicométricas de um instrumento de avaliação

The purpose of this study was to conduct an exploratory factorial analysis of Problems in School, a teachers' motivational styles evaluation instrument, constructed by Deci et al. The original instrument is in a Likert-scale format with the underlying assumption of the existence of a continuum of four different styles contributing to promote students' autonomy. Translated into portuguese, the instrument was applied to 582 elementary and junior high school teachers from several regions of Brazil. Factorial analyses revealed a solution with four orthogonal distinct factors, the authors' initial supposition (existence of a continuum) was not confirmed. In fact, only two opposite styles (both high promotion of autonomy and of control) corresponded to the Deci et al. original ideas. Problems regarding the validity of the other remaining styles emerged. Data was discussed and a revised version of the scale was developed. Directions for further research were also suggested.

A construção de uma escala de estratégias de aprendizagem para alunos do ensino fundamental

Although learning strategies are important tools for schooling process, there is a lack of national instruments to evaluate their knowledge by brazilian students. Therefore, the objectives of this paper are to describe the steps necessary for the construction of a scale to evaluate the learning strategies for basic education students and to present the preliminary study of its psychometric properties. It is also discussed the utility of this instrument for diagnosis, intervention and prevention in school and educational psychology.

Aprendizagem autorregulada da leitura: resultados positivos de uma intervenção psicopedagógica

The purpose of this study was to evaluate the effects of a pedagogical intervention to improve the reading comprehension of fourth grade students of a public primary school. Two classes of 28 students were randomly assigned to an experimental or control group. The students were assessed during three different moments by means of an informative questionnaire, a Learning Strategies Scale and two cloze tests for reading comprehension. The intervention consisted of seven sessions which included learning strategies instruction, reading strategies instruction, meta-cognition activation, motivational support and study guidance. Results showed improvement in meta-cognition and in reading comprehension in both groups. However, gains were higher and more consistent in the experimental group.

Medo, ansiedade e controle relacionados ao tratamento odontológico

The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Children’s Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeitos de diferentes protocolos de treinamento físico sobre o controle autonômico e cardiorrespiratório em homens de meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito neuromuscular das técnicas fisioterapeuticas bandagem funcional e corrente interferencial na síndrome tensional cervical

Universidade Estadual de Campinas . Faculdade de Educação Física

Avaliação da aplicação do Metodo Mulligan e massoterapia classica nas disfunções da articulação temporomandibular em mulheres adultas por meio da escala visual-numerica de dor e pelo SF-36

Universidade Estadual de Campinas . Faculdade de Educação Física

Aspectos motores da Paralisia Cerebral Espástica diparética : o Nintendo WII 'MARCA REGISTRADA' como atividade motora complementar = Motor aspects of Spastic Cerebral Palsy : the Nintendo WII 'TRADEMARK' as a supplementary motor activity

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física

Escala de autoaceitação para pessoas com cegueira congênita ou precoce : desenvolvimento e investigação psicométrica = Self-acceptance acale for people with congenital or early blindness : development and psychometric analysis

Universidade Estadual de Campinas . Faculdade de Educação Física