Synthesis & retention mechanisms of novel mixed mode stationary phase for detection of specific polar low molecular weight biological samples

The thesis primarily reports the synthesis, characterization and application of novel mixed mode stationary phases for Hydrophilic Interaction Liquid Chromatography (HILIC). HILIC is a rapidly emerging chromatographic mode that is finding great applicability in the analysis of polar organic molecules. In addition, there is a chapter on the analysis of Bisphenol A and related species using capillary electrophoresis (CE) coupled with boron-doped diamond electrodes for electrochemical detection. The synthesis and characterization of the novel mixed mode stationary phases prepared in this work is an important contribution to the field as the materials prepared exhibited better performance than similar materials obtained commercially. In addition a more thorough characterization of the materials (e.g.,thermogravimetric analysis, various NMR modes, elemental analysis, etc.) and resulting columns (e.g., H) than is typically encountered. The application of these new materials to the analysis of sugars using evaporative light scattering is also novel. In CE studies, electrochemical detection is sufficiently rare that the work is also novel.

Hazelnut Allergens: Molecular Characterisation, Detection and Clinical Relevance

In the last years, special attention has been devoted to food-induced allergies, from which hazelnut allergy is highlighted. Hazelnut is one of the most commonly consumed tree nuts, being largely used by the food industry in a wide variety of processed foods. It has been regarded as a food with potential health benefits, but also as a source of allergens capable of inducing mild to severe allergic reactions in sensitised individuals. Considering the great number of reports addressing hazelnut allergens, with an estimated increasing trend, this review intends to assemble all the relevant information available so far on the main issues: prevalence of tree nut allergy, clinical threshold levels, molecular characterisation of hazelnut allergens (Cor a 1, Cor a 2, Cor a 8, Cor a 9, Cor a 10, Cor a 11, Cor a 12, Cor a 14 and Cor a TLP) and their clinical relevance, and methodologies for hazelnut allergen detection in foods. A comprehensive overview on the current data about the molecular characterisation of hazelnut allergens is presented, relating biochemical classification and biological function with clinical importance. Recent advances on hazelnut allergen detection methodologies are summarised and compared, including all the novel protein- and DNA-based approaches.

Molecular and serological detection of occult hepatitis B virus among healthy hepatitis B surface antigen-negative blood donors in Malaysia.

Background: Occult hepatitis B infections are becoming a major global threat, but the available data on its prevalence in various parts of the world are often divergent. Objective: This study aimed to detect occult hepatitis B virus in hepatitis B surface antigen-negative serum using anti-HBc as a marker of previous infection. Patient and Methods: A total of 1000 randomly selected hepatitis B surface antigen-negative sera from blood donors were tested for hepatitis B core antibody and hepatitis B surface antibody using an ELISA and nested polymerase chain reaction was done using primers specific to the surface gene (S-gene). Results: Of the 1000 samples 55 (5.5%) were found to be reactive, of which 87.3% (48/55) were positive for hepatitis B surface antibody, indicating immunity as a result of previous infection however, that does not exclude active infection with escaped mutant HBV. Nested PCR results showed the presence of hepatitis B viral DNA in all the 55 samples that were positive for core protein, which is in agreement with the hepatitis B surface antibody result. Conclusion: This study reveals the 5.5% prevalence of occult hepatitis B among Malaysian blood donors as well as the reliability of using hepatitis B core antibody in screening for occult hepatitis B infection in low endemic, low socioeconomic settings.

Behavioral and molecular genetics of reading-related AM and FM detection thresholds

Auditory detection thresholds for certain frequencies of both amplitude modulated (AM) and frequency modulated (FM) dynamic auditory stimuli are associated with reading in typically developing and dyslexic readers. We present the first behavioral and molecular genetic characterization of these two auditory traits. Two extant extended family datasets were given reading tasks and psychoacoustic tasks to determine FM 2 Hz and AM 20 Hz sensitivity thresholds. Univariate heritabilities were significant for both AM (h2 = 0.20) and FM (h2 = 0.29). Bayesian posterior probability of linkage (PPL) analysis found loci for AM (12q, PPL = 81 %) and FM (10p, PPL = 32 %; 20q, PPL = 65 %). Bivariate heritability analyses revealed that FM is genetically correlated with reading, while AM was not. Bivariate PPL analysis indicates that FM loci (10p, 20q) are not also associated with reading.

Detection and molecular characterization of Grapevine yellow speckle viroid 1 isolates infecting grapevines in Brazil.

Abstract Presently, Hop stunt viroid(HSVd) and Citrus exocortis viroid (CEVd) are the only viroids reported to infect grapevines (Vitis spp.) in Brazil, among the seven viroid species already reported infecting this host in other countries. All grapevine viroid diseases are graft-transmissible and can induce losses especiallywhenassociatedwithviruses.Theaimofthisworkwas to confirm infection by Grapevine yellow speckle viroid 1(GYSVd-1) in grapevine samples exhibiting yellow speckle symptoms in the leaves and in asymptomatic samples sequenced by next generation sequencing (NGS). The occurrence of this viroid in Brazil was further investigated in a second study. Total RNAs and dsRNAs were extracted from five symptomatic plants and 16 asymptomatic samples, respectively. Specific primers were used for RT-PCR and amplified DNA fragments were cloned and sequenced by the Sanger method. Eleven complete nucleotide sequences of GYSVd-1 isolates (366 ?367 nt) were obtained from NGS and from RT-PCR amplicons. Comparisons showed high identities (95.9 ?100 %) among ten isolates and an identity of 87.2 ?90.4 % with a divergent isolate (RM-BR). Phylogenetic analyses placed GYSVd-1 isolates in four clusters (types 1, 2, 3 and 4). All GYSVd-1 infections were confirmed by conventional RT-PCR and RT-qPCR using specific oligonucleo-tides and a labeled probe. This is the first report and molecular characterization of GYSVd-1 infecting grapevines in Brazil, and our survey indicates that this viroid could be widespread in the major grape producing regions of Brazil. Keywords GYSVd-1 . Incidence . Next generation sequencing. Secondary structure. Vine.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

A closer look at multiple-clone Plasmodium vivax infections: detection methods, prevalence and consequences

The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.

Detection of Hepatitis B virus subgenotype A1 in a Quilombo community from Maranhao, Brazil

Background: The Brazilian population is mainly descendant from European colonizers, Africans and Native Americans. Some Afro-descendants lived in small isolated communities since the slavery period. The epidemiological status of HBV infection in Quilombos communities from northeast of Brazil remains unknown. The aim of this study was to characterize the HBV genotypes circulating inside a Quilombo isolated community from Maranhao State, Brazil. Methods: Seventy-two samples from Frechal Quilombo community at Maranhao were collected. All serum samples were screened by enzyme-linked immunosorbent assays for the presence of hepatitis B surface antigen ( HBsAg). HBsAg positive samples were submitted to DNA extraction and a fragment of 1306 bp partially comprising HBsAg and polymerase coding regions (S/POL) was amplified by nested PCR and its nucleotide sequence was determined. Viral isolates were genotyped by phylogenetic analysis using reference sequences from each genotype obtained from GenBank (n = 320). Sequences were aligned using Muscle software and edited in the SE-AL software. Bayesian phylogenetic analyses were conducted using Markov Chain Monte Carlo (MCMC) method to obtain the MCC tree using BEAST v.1.5.3. Results: Of the 72 individuals, 9 (12.5%) were HBsAg-positive and 4 of them were successfully sequenced for the 1306 bp fragment. All these samples were genotype A1 and grouped together with other sequences reported from Brazil. Conclusions: The present study represents the first report on the HBV genotypes characterization of this community in the Maranhao state in Brazil where a high HBsAg frequency was found. In this study, we reported a high frequency of HBV infection and the exclusive presence of subgenotype A1 in an Afro-descendent community in the Maranhao State, Brazil.

Detection of polymorphisms of the mtDNA control region of Caretta caretta (Testudines: Cheloniidae) by PCR-SSCP

Marine turtles are increasingly being threatened worldwide by anthropogenic activities. Better understanding of their life cycle, behavior and population structure is imperative for the design of adequate conservation strategies. The mtDNA control region is a fast-evolving matrilineal marker that has been employed in the study of marine turtle populations. We developed and tested a simple molecular tracing system for Caretta caretta mtDNA haplotypes by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). Using this technique, we were able to distinguish the SSCP patterns of 18 individuals of the haplotypes CC-A4, CC-A24 and CCxLO, which are commonly found in turtles sampled on the Brazilian coast. When we analyzed 15 turtles with previously unknown sequences, we detected two other haplotypes, in addition to the other four. Based on DNA sequencing, they were identified as the CC-A17 and CC-A1 haplotypes. Further analyses were made with the sea turtles, Chelonia mydas (N = 8), Lepidochelys olivacea (N = 3) and Eretmochelys imbricata (N = 1), demonstrating that the PCR-SSCP technique is able to distinguish intra-and interspecific variation in the family Cheloniidae. We found that this technique can be useful for identifying sea turtle mtDNA haplotypes, reducing the need for sequencing.

Detection of catechol using mixed Langmuir-Blodgett films of a phospholipid and phthalocyanines as voltammetric sensors

The combination of metallic phthalocyanines (MPcs) and biomolecules has been explored in the literature either as mimetic systems to investigate molecular interactions or as supporting layers to immobilize biomolecules. Here, Langmuir-Blodgett (LB) films containing the phospholipid dimyristoyl phosphatidic acid (DMPA) mixed either with iron phthalocyanine (FePc) or with lutetium bisphthalocyanine (LuPc(2)) were applied as ITO modified-electrodes in the detection of catechol using cyclic voltammetry. The mixed Langmuir films of FePc + DMPA and LuPc(2) + DMPA displayed surface-pressure isotherms with no evidence of molecular-level interactions. The Fourier Transform Infrared (FTIR) spectra of the multilayer LB films confirmed the lack of interaction between the components. The DMPA and the FePc molecules were found to be oriented perpendicularly to the substrate, while LuPc(2) molecules were randomly organized. The phospholipid matrix induced a remarkable electrocatalytic effect on the phthalocyanines; as a result the mixed LB films deposited on ITO could be used to detect catechol with detection limits of 4.30 x 10(-7) and 3.34 x 10(-7) M for FePc + DMPA and LuPc(2) + DMPA, respectively. Results from kinetics experiments revealed that ion diffusion dominated the response of the modified electrodes. The sensitivity was comparable to that of other non-enzymatic sensors, which is sufficient to detect catechol in the food industry. The higher stability of the electrochemical response of the LB films and the ability to control the molecular architecture are promising for further studies with incorporation of biomolecules.

Validation of dot blot hybridization and denaturing high performance liquid chromatography as reliable methods for TP53 codon 72 genotyping in molecular epidemiologic studies

Background: Mutations in TP53 are common events during carcinogenesis. In addition to gene mutations, several reports have focused on TP53 polymorphisms as risk factors for malignant disease. Many studies have highlighted that the status of the TP53 codon 72 polymorphism could influence cancer susceptibility. However, the results have been inconsistent and various methodological features can contribute to departures from Hardy-Weinberg equilibrium, a condition that may influence the disease risk estimates. The most widely accepted method of detecting genotyping error is to confirm genotypes by sequencing and/or via a separate method. Results: We developed two new genotyping methods for TP53 codon 72 polymorphism detection: Denaturing High Performance Liquid Chromatography (DHPLC) and Dot Blot hybridization. These methods were compared with Restriction Fragment Length Polymorphism (RFLP) using two different restriction enzymes. We observed high agreement among all methodologies assayed. Dot-blot hybridization and DHPLC results were more highly concordant with each other than when either of these methods was compared with RFLP. Conclusions: Although variations may occur, our results indicate that DHPLC and Dot Blot hybridization can be used as reliable screening methods for TP53 codon 72 polymorphism detection, especially in molecular epidemiologic studies, where high throughput methodologies are required.

A sensor array based on mass and capacitance transducers for the detection of adulterated gasolines

The simultaneous use of different sensors technologies is an efficient method to increase the performance of chemical sensors systems. Among the available technologies, mass and capacitance transducers are particularly interesting because they can take advantage also from non-conductive sensing layers, such as most of the more interesting molecular recognition systems. In this paper, an array of quartz microbalance sensors is complemented by an array of capacitors obtained from a commercial biometrics fingerprints detector. The two sets of transducers, properly functionalized by sensitive molecular and polymeric films, are utilized for the estimation of adulteration in gasolines, and in particular to quantify the content of ethanol in gasolines, an application of importance for Brazilian market. Results indicate that the hybrid system outperforms the individual sensor arrays even if the quantification of ethanol in gasoline, due to the variability of gasolines formulation, is affected by a barely acceptable error. (C) 2009 Elsevier B.V. All rights reserved.

Genetic Diversity and a PCR-Based Method for Xanthomonas axonopodis Detection in Passion Fruit

Xanthomonas axonopodis pv. passiflorae causes bacterial spot in passion fruit. It attacks the purple and yellow passion fruit as well as the sweet passion fruit. The diversity of 87 isolates of pv. passiflorae collected from across 22 fruit orchards in Brazil was evaluated using molecular profiles and statistical procedures, including an unweighted pair-group method with arithmetical averages-based dendrogram, analysis of molecular variance (AMOVA), and an assigning test that provides information on genetic structure at the population level. Isolates from another eight pathovars were included in the molecular analyses and all were shown to have a distinct repetitive sequence-based polymerase chain reaction profile. Amplified fragment length polymorphism technique revealed considerable diversity among isolates of pv. passiflorae, and AMOVA showed that most of the variance (49.4%) was due to differences between localities. Cluster analysis revealed that most genotypic clusters were homogeneous and that variance was associated primarily with geographic origin. The disease adversely affects fruit production and may kill infected plants. A method for rapid diagnosis of the pathogen, even before the disease symptoms become evident, has value for producers. Here, a set of primers (Xapas) was designed by exploiting a single-nucleotide polymorphism between the sequences of the intergenic 16S-23S rRNA spacer region of the pathovars. Xapas was shown to effectively detect all pv. passiflorae isolates and is recommended for disease diagnosis in passion fruit orchards.