Myocardial Extracellular Volume Expansion And The Risk Of Recurrent Atrial Fibrillation After Pulmonary Vein Isolation.

This study tested whether myocardial extracellular volume (ECV) is increased in patients with hypertension and atrial fibrillation (AF) undergoing pulmonary vein isolation and whether there is an association between ECV and post-procedural recurrence of AF. Hypertension is associated with myocardial fibrosis, an increase in ECV, and AF. Data linking these findings are limited. T1 measurements pre-contrast and post-contrast in a cardiac magnetic resonance (CMR) study provide a method for quantification of ECV. Consecutive patients with hypertension and recurrent AF referred for pulmonary vein isolation underwent a contrast CMR study with measurement of ECV and were followed up prospectively for a median of 18 months. The endpoint of interest was late recurrence of AF. Patients had elevated left ventricular (LV) volumes, LV mass, left atrial volumes, and increased ECV (patients with AF, 0.34 ± 0.03; healthy control patients, 0.29 ± 0.03; p < 0.001). There were positive associations between ECV and left atrial volume (r = 0.46, p < 0.01) and LV mass and a negative association between ECV and diastolic function (early mitral annular relaxation [E'], r = -0.55, p < 0.001). In the best overall multivariable model, ECV was the strongest predictor of the primary outcome of recurrent AF (hazard ratio: 1.29; 95% confidence interval: 1.15 to 1.44; p < 0.0001) and the secondary composite outcome of recurrent AF, heart failure admission, and death (hazard ratio: 1.35; 95% confidence interval: 1.21 to 1.51; p < 0.0001). Each 10% increase in ECV was associated with a 29% increased risk of recurrent AF. In patients with AF and hypertension, expansion of ECV is associated with diastolic function and left atrial remodeling and is a strong independent predictor of recurrent AF post-pulmonary vein isolation.

Oropouche Virus Infection And Pathogenesis Is Restricted By Mavs, Irf-3, Irf-7, And Type I Ifn Signaling Pathways In Non-myeloid Cells.

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Immune cells and oxidative stress in the endotoxin tolerance mouse model

Sepsis is a systemic inflammatory response that can lead to tissue damage and death. In order to increase our understanding of sepsis, experimental models are needed that produce relevant immune and inflammatory responses during a septic event. We describe a lipopolysaccharide tolerance mouse model to characterize the cellular and molecular alterations of immune cells during sepsis. The model presents a typical lipopolysaccharide tolerance pattern in which tolerance is related to decreased production and secretion of cytokines after a subsequent exposure to a lethal dose of lipopolysaccharide. The initial lipopolysaccharide exposure also altered the expression patterns of cytokines and was followed by an 8- and a 1.5-fold increase in the T helper 1 and 2 cell subpopulations. Behavioral data indicate a decrease in spontaneous activity and an increase in body temperature following exposure to lipopolysaccharide. In contrast, tolerant animals maintained production of reactive oxygen species and nitric oxide when terminally challenged by cecal ligation and puncture (CLP). Survival study after CLP showed protection in tolerant compared to naive animals. Spleen mass increased in tolerant animals followed by increases of B lymphocytes and subpopulation Th1 cells. An increase in the number of stem cells was found in spleen and bone marrow. We also showed that administration of spleen or bone marrow cells from tolerant to naive animals transfers the acquired resistance status. In conclusion, lipopolysaccharide tolerance is a natural reprogramming of the immune system that increases the number of immune cells, particularly T helper 1 cells, and does not reduce oxidative stress.

Microbiological and histopathological aspects of canine pyometra

As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study also consisted of the counting of microorganisms colonies forming units in samples of intrauterine content, tests of antimicrobial susceptibility of the E. coli isolates and the histological examination of the uterus. E. coli was the most prevalent microorganism isolated (76.6%) and 120 strains (79.5%) were positive for sfa, 86 (56.9%) were positive for cnf, 87 (57.6%) were positive for pap, 52 (34.4%) were positive for hly, 51 (33.8%) were positive for iuc and 5 (3.3%) were positive for afa genes. One observed more sensitivity of E. coli to norfloxacin, polimixin B, sulphazotrin, chloranfenicol and enrofloxacin. In 42% of the samples of uterine walls where microorganisms were isolated, the sizes of the areas of the inflammatory responses corresponded to 39-56%. Virulence factors were identified in 98.0% of the strains evaluated, demonstrating a high frequency of potentially pathogenic E. coli. It must be considered that dogs are animals that are living in close proximity to man for thousands of years and have an important role in the transmission of E. coli to other animals and to man.

Cytotoxic activity of a dichloromethane extract and fractions obtained from Eudistoma vannamei (Tunicata: Ascidiacea)

This study consists of the bioassay-guided fractionation of the dichloromethane extract from Eudistoma vannamei and the pharmacological characterization of the active fractions. The dried hydromethanolic extract dissolved in aqueous methanol was partitioned with dichloromethane and chromatographed on a silica gel flash column. The anti-proliferative effect was monitored by the MTT assay. Four of the latest fractions, numbered 14 to 17, which held many chemical similarities amongst each other, were found to be the most active. The selected fractions were tested for viability, proliferation and death induction on cultures of HL-60 promycloblastic leukemia cells. The results suggested that the observed cytotoxicity is related to apoptosis induction. (C) 2007 Elsevier Inc. All rights reserved.

A case-control study of employment status and mortality in a cohort of Australian youth

Recent studies have demonstrated a link in young populations between unemployment and ill health. The purpose of this study is to correlate mortality with employment status in two cohorts of young Australian males, aged 17-25 years, from 1984 to 1988. Two youth cohorts consisting of an initially unemployed sample (n = 1424 males) and a population sample (n = 4573 males), were surveyed annually throughout the study period. Those lost to follow-up during the survey period were matched with death registries across Australia. Employment status was determined from weekly diaries and death certificates and was designated as: employed or student; unemployed; not in the work force (excluding students). Conditional logistic regression, using age- and cohort- matched cases (deaths) and controls (alive), was used to estimate the odds ratio (OR) of dying with regard to employment status, taking into account potential confounders such as ethnicity, aboriginality, educational attainment, pre-existing health problems, socio-economic status of parents, and other factors. Twenty three male survey respondents were positively matched to death registry records. Compared to those employed or students (referent group), significantly elevated ORs were found to be associated with neither being in the workforce nor a student for all cause, external cause, and external cause mortality other than suicide. Odds ratios were adjusted for age, survey cohort, ethnicity, pre-existing physical and mental health status, education level, and socio-economic status of parent(s). A statistically significant increasing linear trend in odds ratios of male mortality for most cause groups was found across the employment categories, from those employed or student (lowest ORs), through those unemployed; to those not in the workforce (highest ORs). Suicide was higher, but not statistically significantly, in those unemployed or not in the workforce. Suicide also was associated, though not significantly, with the respondent not living with their parents when they were 14 years of age. No association was found between mortality and past unemployment experience, as measured by length of time spent unemployed, or the number of spells of unemployment experienced during the survey. The results of this study underscore the elevated risk to survival in young males as a consequence of being neither employed nor a student. (C) 1999 Elsevier Science Ltd. All rights reserved.

Long-term disability after first-ever stroke and related prognostic factors in the Perth Community Stroke Study, 1989-1990

Background and Purpose-Few reliable estimates of the long-term functional outcome after stroke are available. This population-based study aimed to describe disability, dependency, and related independent prognostic factors at 5 years after,a first-ever stroke in patients in Perth, Western Australia. Methods-All individuals with a suspected acute stroke who were resident in a geographically defined region (population, 138 708) of Perth, Western Australia, were registered prospectively and assessed according to standardized diagnostic criteria over a period of 18 months in 1989 to 1990. Patients were followed up prospectively at 4 and 12 months and 5 years after the index event. Results-There were 370 cases of first-ever stroke, and 277 patients survived to 30 days. Of these early survivors, 152 (55%) were alive at 5 years, and among those who were neither institutionalized (n=146) nor disabled (n=129) at the time of their stroke, 21 (14%) were institutionalized in a nursing home, and 47 (36%) were disabled. The most important predictors of death or disability at 5 years were increasing age, baseline disability defined by a Barthel Index score of <20/20 (odds ratio [OR], 6.3; 95% confidence interval [CI], 2.7 to 14), moderate hemiparesis (OR, 2.7. 95% CI, 1.1 to 6.2), severe hemiparesis (OR, 4.5; 95% CI, 1.1 to 19), and recurrent stroke (OR, 9.4; 95% CI, 3.0 to 30). A low level of activity before the stroke was a significant predictor of institutionalization, and subsequent recurrent stroke was a consistent, independent predictor of institutionalization, disability, and death or institutionalization, increasing the odds of each of these 3 adverse outcomes by 5- to 15-fold. Conclusions-Among 30-day survivors of first-ever stroke, about half survive 5 years; of survivors, one third remain disabled, and I in 7 are in permanent institutional care. The major modifiable predictors of poor long-term outcome are a low level of activity before the stroke and subsequent recurrent stroke. Efforts to increase physical activity among the elderly and to prevent recurrent stroke in survivors of a first stroke are likely to reduce the long-term burden of cerebrovascular disease.

Constitutively Active Mutant D816VKit Induces Megakayocyte and Mast Cell Differentiation of Early Haemopoietic Cells from Murine Foetal Liver

Mutations of Kit at position D816 have been implicated in mastocytosis, acute myeloid leukaemia and germ cell tumours. Expression of this mutant Kit in cell lines results in factor-independent growth, differentiation and increased survival in vitro and tumourigenicity in vivo. Mutant D816VKit and wild-type Kit were expressed in murine primary haemopoietic cells and grown in stem cell factor (SCF) or the absence of factors. Expression of D816VKit did not lead to transformation as assessed by a colony assay, but resulted in enhanced differentiation of cells when compared to control cells. D816VKit induced an increase in the number of cells differentiating along the megakaryocyte lineage in the absence of factors. SCF had an added effect with an increase in differentiation of mast cells. Expression of wild-type Kit in the presence of SCF also failed to cause transformation and induced differentiation of mast cells and megakaryocytes. We conclude that constitutive expression of D816VKit in primary haemopoietic cells is not a sufficient transforming stimulus but leads to the survival and maturation of cells whose phenotype is influenced by the presence of SCF. (C) 2003 Elsevier Science Ltd. All rights reserved.

Molecular evolution and phylogeny of elapid snake venom three-finger toxins

Animal venom components are of considerable interest to researchers across a wide variety of disciplines, including molecular biology, biochemistry, medicine, and evolutionary genetics. The three-finger family of snake venom peptides is a particularly interesting and biochemically complex group of venom peptides, because they are encoded by a large multigene family and display a diverse array of functional activities. In addition, understanding how this complex and highly varied multigene family evolved is an interesting question to researchers investigating the biochemical diversity of these peptides and their impact on human health. Therefore, the purpose of our study was to investigate the long-term evolutionary patterns exhibited by these snake venom toxins to understand the mechanisms by which they diversified into a large, biochemically diverse, multigene family. Our results show a much greater diversity of family members than was previously known, including a number of subfamilies that did not fall within any previously identified groups with characterized activities. In addition, we found that the long-term evolutionary processes that gave rise to the diversity of three-finger toxins are consistent with the birth-and-death model of multigene family evolution. It is anticipated that this three-finger toxin toolkit will prove to be useful in providing a clearer picture of the diversity of investigational ligands or potential therapeutics available within this important family.

Deaths from cirrhosis in Poland and Hungary: The impact of different alcohol policies during the 1980s

Objective - To compare patterns of deaths from cirrhosis in Poland and Hungary in the context of differing alcohol policies in the 1980s. Design - Cohort analysis of deaths from chronic Liver disease and cirrhosis between 1959 and 1992 using mortality data from the World Health Organization database. Results - The pattern of alcohol related mortality in these countries is quite different. In both countries, death rates increased in the 1960s and 1970s. In Poland, this increase was arrested in 1980 and death rates have levelled out, with the exception of those in young females. In Hungary, rates have continued to climb, although the rate of increase decreased in the 1980s. This change coincides with the introduction of a policy, following the introduction of martial law, to reduce alcohol consumption. Conclusions - The countries of central and eastern Europe display many similarities in both political history and measures of health such as overall life expectancy. When examined more closely, substantial differences emerge. Policy makers must be cautious about adopting global solutions to health challenges that fail to take into account national variations.

Outpatient treatment with intravenous antimicrobial therapy and oral levofloxacin in patients with febrile neutropenia and hematological malignancies

The purpose of this study was to evaluate outcomes such as success of the initial therapy, failure of outpatient treatment, and death in outpatient treatment during intravenous antimicrobial therapy in patients with febrile neutropenia (FN) and hematological malignancies. In addition, clinical and laboratory data and the Multinational Association for Supportive Care of Cancer index (MASCC) were compared with failure of outpatient treatment and death. In a retrospective study, we evaluated FN following chemotherapy events that were treated initially with cefepime, with or without teicoplanin and replaced by levofloxacin after 48 h of defervescence in patients with good general conditions and ANC > 500/mm(3). Of the 178 FN episodes occurred in 126 patients, we observed success of the initial therapy in 63.5% of the events, failure of outpatient treatment in 20.8%, and death in 6.2%. The success rate of oral levofloxacin after defervescence was 99% (95 out of 96). Using multivariate analysis, significant risks of failure of outpatient treatment were found to be smoking (odds ratio (OR) 3.14, confidence interval (CI) 1.14-8.66; p = 0.027) and serum creatinine levels > 1.2 mg/dL (OR 7.97, CI 2.19-28.95; p = 0.002). With regard to death, the risk found was oxygen saturation by pulse oximetry < 95% (OR 5.8, IC 1.50-22.56; p = 0.011). Using the MASCC index, 165 events were classified as low risk and 13 as high risk. Failure of outpatient treatment was reported in seven (53.8%) high-risk and 30 (18.2%) low-risk episodes (p = 0.006). In addition, death occurred in seven (4.2%) low-risk and four (30.8%) high-risk events (p = 0.004). Ours results show that MASCC index was able to identify patients with high risk. In addition, non-smoking, serum creatinine levels a parts per thousand currency sign1.2 mg/dL, and oxygen saturation by pulse oximetry a parts per thousand yen95% were protection factors.

Association between ADAMTS13 polymorphisms and risk of cardiovascular events in chronic coronary disease

Introduction: Association between ADAMTS13 levels and cardiovascular events has been described recently. However, no genetic study of ADAMTS13 in coronary patients has been described. Materials and Methods: Based on related populations frequencies and functional studies, we tested three ADAMTS13 polymorphisms: C1342G (Q448E), C1852G (P618A) and C2699T (A900V) in a group of 560 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. The incidence of the 5-year end-points of death and death from cardiac causes, myocardial infarction, refractory angina requiring revascularization and cerebrovascular accident was determined for each polymorphim`s allele, genotype and haplotype. Risk was assessed with the use of logistic regression and Cox proportional-hazards model and multivariable adjustment was employed for possible confounders. Results: Clinical characteristics and received treatment of each genotype group were similar at baseline. In an adjusted model for cardiovascular risk variables, we were able to observe a significant association between ADAMTS13 900V variant and an increased risk of death (OR: 1,92 CI: 1,14-3,23, p = 0,015) or death from cardiac cause (OR: 2,67, CI: 1,59-4,49, p = 0,0009). No association between events and ADAMTS13 Q448E or P618A was observed. Conclusions: This first report studying the association between ADAMTS13 genotypes and cardiovascular events provides evidence for the association between ADAMTS13 900V variant and an increased risk of death in a population with multi-vessel CAD. (C) 2009 Elsevier Ltd. All rights reserved.