AN INJECTOR AMPLIFIER DOUBLE TARGET CONFIGURATION FOR THE NE-LIKE GE X-RAY LASER SCHEME

The XUV lasing output from one germanium slab target has been efficiently coupled into, and further amplified in, a second plasma produced by irradiation of a similar target from the opposite direction. The operation of such a double target was shown to be strongly dependent on the distance by which the two target surfaces were displaced. The line brightness peaked for a surface displacement of approximately 200-mu-m and it was observed that the pointing direction of one output beam could be controlled by the surface separation in an asymmetric geometry. Gain length products of approximately 16 with estimated output powers close to the megawatt level were achieved on both the 23.2 and 23.6 nm J=2-1 transitions for an optimised target configuration. Maximum effective coupling efficiencies of the individual outputs from double targets, comprising 2.2 and 1.4 cm length components, approached 100% for beams propagating from the shorter to the longer target.

DNA double-strand break distributions in X-ray and alpha-particle irradiated V79 cells: Evidence for non-random breakage

Many studies have shown that with increasing LET of ionizing radiation the RBE (relative biological effectiveness) for dsb (double strand breaks) induction remains around 1.0 despite the increase in the RBE for cell killing. This has been attributed to an increase in the complexity of lesions, classified as dsb with current techniques, at multiply damaged sites. This study determines the molecular weight distributions of DNA from Chinese hamster V79 cells irradiated with X-rays or 110 keV/mu m alpha-particles. Two running conditions for pulsed-field gel-electrophoresis were chosen to give optimal separation of fragments either in the 225 kbp-5.7 Mbp range or the 0.3 kbp to 225 kbp range. Taking the total fraction of DNA migrating into the gel as a measure of fragmentation, the RBE for dsb induction was less than 1.0 for both molecular weight regions studied. The total yields of dsb were 8.2 x 10(-9) dsb/Gy/bp for X-rays and 7.8 x 10(-9) dsb/Gy/bp for a-particles, measured using a random breakage model. Analysis of the RBE of alpha-particles versus molecular weight gave a different response. In the 0.4 Mbp-57 Mbp region the RBE was less than 1.0; however, below 0.4 Mbp the RBE increased above 1.0. The frequency distributions of fragment sizes were found to differ from those predicted by a model assuming random breakage along the length of the DNA and the differences were greater for alpha-particles than for X-rays. An excess of fragments induced by a single-hit mechanism was found in the 8-300 kbp region and for X-rays and alpha-particles these corresponded to an extra 0.8 x 10(-9) and 3.4 x 10(-9) dsb/bp/Gy, respectively. Thus for every alpha-particle track that induces a dsb there is a 44% probability of inducing a second break within 300 kbp and for electron tracks the probability is 10%. This study shows that the distribution of damage from a high LET alpha-particle track is significantly different from that observed with low LET X-rays. In particular, it suggests that the fragmentation patterns of irradiated DNA may be related to the higher-order chromatin repealing structures found in intact cells.

The measured variation of the Debye-Waller factor of aluminum from 295K to 815K by using the energy dispersive x-ray diffraction technique

The Energy Dispersive X-ray Diffraction System at Brock University has been used to measure the intensities of the diffraction lines of aluminum powder sample as a function of temperature. At first, intensity measurements at high temperature were not reproducible. After some modifications have been made, we were able to measure the intensities of the diffraction lines to 815K, with good accuracy and reproducibility. Therefore the changes of the Debye-Waller factor from room temperature up to 815K for aluminum were determined with precision. Our results are in good agreement with those previously published.

X-ray diffraction studies of muscle : observations on the anterior byssus retractor muscle of Mytilus edulis and the insect flight muscle from Sarcophaga bullata

The interfilament spacing of the anterior byssus retractor muscle from Mytilus edulis was studied as the muscle was extended. It was found that variations in this spacing were very small and consistent with the hypothesis that the interfilament spacing was independent of the extension of the muscle. It was observed that the interfilament spacing was dependent on the osmolarity of the bathing medium. In concentrated solutions of the artificial seawater, the interfilament spacing decreased; while in dilute solutions of artificial seawater, it was observed that the interfilament spacing was increasing. X-ray diffraction patterns were obtained from fresh, and glutaraldehyde fixed, specimens of insect flight muscle from Sarcophaga bullata. There patterns were in general agreement with previous X-ray diffraction studies of insect flight muscle. A reflexion G at 93A was observed and interpreted as arising from diffraction in the mitochondria. Specimens of dried insect flight muscle produced a diffraction pattern consisting of arc and ring reflexions. This was interpreted as suggesting an ordered arrangement of cristae, in the mitochondria from these muscles.

X-ray diffraction from Al powder using energy dispersive technique

Using the energy dispersive x ...ray diffraction (EDXD) technique, the room temperature diffraction pattern of Al powder was obtained at diffraction angles ~ 30° and 50°. From the small angle diffraction pattern the average relative intensities (IR) of the (111), (200), and (220) lines were measured to be equal to 100, 62, and 32 respectively. From the large diffraction angle IR for the (220), (311+222), (400), (331+420), and (422) lines were measured to be 100,201,17,90, and 19.5 respectively. The diffraction pattern at those two angles were obtained at several higher temperatures to measure the change in the intensities of the Al lines. From the intensity changes the increase of the Debye- Waller temperature factor, i.e ~B(T), with respect to the value at room temperature was determined to be 0.6+0.1 at 250°C, 1.10+0.15 at 350°C, 1.45+0.20 at 450°C, and 2.20±0.35 at 550°C.

X-ray diffraction of a gram-negative bacterial membrane mimetic

This thesis applies x-ray diffraction to measure he membrane structure of lipopolysaccharides and to develop a better model of a LPS bacterial melilbrane that can be used for biophysical research on antibiotics that attack cell membranes. \iVe ha'e Inodified the Physics department x-ray machine for use 3.'3 a thin film diffractometer, and have lesigned a new temperature and relative humidity controlled sample cell.\Ve tested the sample eel: by measuring the one-dimensional electron density profiles of bilayers of pope with 0%, 1%, 1G :VcJ, and 100% by weight lipo-polysaccharide from Pse'udo'lTwna aeTuginosa. Background VVe now know that traditional p,ntibiotics ,I,re losing their effectiveness against ever-evolving bacteria. This is because traditional antibiotic: work against specific targets within the bacterial cell, and with genetic mutations over time, themtibiotic no longer works. One possible solution are antimicrobial peptides. These are short proteins that are part of the immune systems of many animals, and some of them attack bacteria directly at the membrane of the cell, causing the bacterium to rupture and die. Since the membranes of most bacteria share common structural features, and these featuret, are unlikely to evolve very much, these peptides should effectively kill many types of bacteria wi Lhout much evolved resistance. But why do these peptides kill bacterial cel: '3 , but not the cells of the host animal? For gramnegative bacteria, the most likely reason is that t Ileir outer membrane is made of lipopolysaccharides (LPS), which is very different from an animal :;ell membrane. Up to now, what we knovv about how these peptides work was likely done with r !10spholipid models of animal cell membranes, and not with the more complex lipopolysa,echaricies, If we want to make better pepticies, ones that we can use to fight all types of infection, we need a more accurate molecular picture of how they \vork. This will hopefully be one step forward to the ( esign of better treatments for bacterial infections.

X-ray diffraction, thermal analysis, and Raman scattering study of K2BeF4 and comparation to other member of the (beta)-K2SO4 family with ferroelectric -paraelectric transition

Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

Crystal and molecular structure of the thioether-analogue of PEEK from X-ray powder data and diffraction-modelling

Analysis of X-ray powder data for the melt-crystallisable aromatic poly(thioether thioether ketone) [-S-Ar-S-Ar-CO-Ar](n), ('PTTK', Ar= 1,4-phenylene), reveals that it adopts a crystal structure very different from that established for its ether-analogue PEEK. Molecular modelling and diffraction-simulation studies of PTTK show that the structure of this polymer is analogous to that of melt-crystallised poly(thioetherketone) [-SAr-CO-Ar](n) in which the carbonyl linkages in symmetry-related chains are aligned anti-parallel to one another. and that these bridging units are crystallographically interchangeable. The final model for the crystal structure of PTTK is thus disordered, in the monoclinic space group 121a (two chains per unit cell), with cell dimensions a = 7.83, b = 6.06, c = 10.35 angstrom, beta = 93.47 degrees. (c) 2005 Elsevier Ltd. All rights reserved.

First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

Melt structure and its transformation by sequential crystallization of the two blocks within poly(L-lactide)-block-poly(epsilon-caprolactone) double crystalline diblock copolymers

Sequential crystallization of poly(L-lactide) (PLLA) followed by poly(epsilon-caprolactone) (PCL) in double crystalline PLLA-b-PCL diblock copolymers is studied by differential scanning calorimetry (DSC), polarized optical microscopy (POM), wide-angle X-ray scattering (WAXS) and small-angle X-ray scattering (SAXS). Three samples with different compositions are studied. The sample with the shortest PLLA block (32 wt.-% PLLA) crystallizes from a homogeneous melt, the other two (with 44 and 60% PLLA) from microphase separated structures. The microphase structure of the melt is changed as PLLA crystallizes at 122 degrees C (a temperature at which the PCL block is molten) forming spherulites regardless of composition, even with 32% PLLA. SAXS indicates that a lamellar structure with a different periodicity than that obtained in the melt forms (for melt segregated samples). Where PCL is the majority block, PCL crystallization at 42 degrees C following PLLA crystallization leads to rearrangement of the lamellar structure, as observed by SAXS, possibly due to local melting at the interphases between domains. POM results showed that PCL crystallizes within previously formed PLLA spherulites. WAXS data indicate that the PLLA unit cell is modified by crystallization of PCL, at least for the two majority PCL samples. The PCL minority sample did not crystallize at 42 degrees C (well below the PCL homopolymer crystallization temperature), pointing to the influence of pre-crystallization of PLLA on PCL crystallization, although it did crystallize at lower temperature. Crystallization kinetics were examined by DSC and WAXS, with good agreement in general. The crystallization rate of PLLA decreased with increase in PCL content in the copolymers. The crystallization rate of PCL decreased with increasing PLLA content. The Avrami exponents were in general depressed for both components in the block copolymers compared to the parent homopolymers. Polarized optical micrographs during isothermal crystalli zation of (a) homo-PLLA, (b) homo-PCL, (c) and (d) block copolymer after 30 min at 122 degrees C and after 15 min at 42 degrees C.

Solvent influences on metastable polymorph lifetimes: real-time interconversions using energy dispersive X-ray diffractometry

Solvent influences on the crystallization of polymorph and hydrate forms of the nootropic drug piracetam (2-oxo-pyrrolidineacetamide) were investigated from water, methanol, 2-propanol, isobutanol, and nitromethane. Crystal growth profiles of piracetam polymorphs were constructed using time-resolved diffraction snapshots collected for each solvent system. Measurements were performed by in situ energy dispersive X-ray diffraction recorded in Station 16.4 at the synchrotron radiation source (SRS) at Daresbury Laboratory, CCLRC UK. Crystallizations from methanol, 2-propanol, isobutanol, and nitromethane progressed in a similar fashion with the initial formation of form I which then converted relatively quickly to form II with form III being generated upon further cooling. However, considerable differences were observed for the polymorphs lifetime and both the rate and temperature of conversion using the different solvents. The thermodynamically unstable form I was kinetically favored in isobutanol and nitromethane where traces of this polymorph were observed below 10 degrees C. In contrast, the transformation of form II and subsequent growth of form III were inhibited in 2-propanol and nitromethane solutions. Aqueous solutions produced hydrate forms of piracetam which are different from the reported monohydrate; this crystallization evolved through successive generation of transient structures which transformed upon exchange of intramolecular water between the liquid and crystalline phases. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 96:1069-1078, 2007.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.