Spectrophotometric Evaluation Of Dental Bleaching Under Orthodontic Bracket In Enamel And Dentin.

Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.

Cardioprotective Mechanism Of S-nitroso-n-acetylcysteine Via S-nitrosated Betadrenoceptor-2 In The Ldlr-/- Mice.

Previous studies from our group have demonstrated the protective effect of S-nitroso-N-acetylcysteine (SNAC) on the cardiovascular system in dyslipidemic LDLr-/- mice that develop atheroma and left ventricular hypertrophy after 15 days on a high fat diet. We have shown that SNAC treatment attenuates plaque development via the suppression of vascular oxidative stress and protects the heart from structural and functional myocardial alterations, such as heart arrhythmia, by reducing cardiomyocyte sensitivity to catecholamines. Here we investigate the ability of SNAC to modulate oxidative stress and cell survival in cardiomyocytes during remodeling and correlation with β₂-AR signaling in mediating this protection. Ventricular superoxide (O₂⁻) and hydrogen peroxide (H₂O₂) generation was measured by HPLC methods to allow quantification of dihydroethidium (DHE) products. Ventricular histological sections were stained using terminal dUTP nick-end labeling (TUNEL) to identify nuclei with DNA degradation (apoptosis) and this was confirmed by Western blot for cleaved caspase-3 and caspase-7 protein expression. The findings show that O₂⁻ and H₂O₂ production and also cell apoptosis were increased during left ventricular hypertrophy (LVH). SNAC treatment reduced oxidative stress during on cardiac remodeling, measured by decreased H₂O₂ and O₂⁻ production (65% and 52%, respectively), and a decrease in the ratio of p-Ser1177 eNOS/total eNOS. Left ventricle (LV) from SNAC-treated mice revealed a 4-fold increase in β₂-AR expression associated with coupling change to Gi; β₂-ARs-S-nitrosation (β₂-AR-SNO) increased 61%, while apoptosis decreased by 70%. These results suggest that the cardio-protective effect of SNAC treatment is primarily through its anti-oxidant role and is associated with β₂-ARs overexpression and β₂-AR-SNO via an anti-apoptotic pathway.

Reduction Of Oxidative Damage And Inflammatory Response In The Diaphragm Muscle Of Mdx Mice Using Iron Chelator Deferoxamine.

Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.

Biochemical And Morphological Alterations In The Achilles Tendon Of Mdx Mice.

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

Chronic Continuous Exenatide Infusion Does Not Cause Pancreatic Inflammation And Ductal Hyperplasia In Non-human Primates.

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.

P16(ink) (4a) Expression As A Potential Marker Of Low-grade Cervical Intraepithelial Neoplasia Progression.

To evaluate p16(INK) (4a) immunoexpression in CIN1 lesions looking for differences between cases that progress to CIN2/3 maintain CIN1 diagnosis, or spontaneously regress. Seventy-four CIN1 biopsies were studied. In the follow-up, a second biopsy was performed and 28.7% showed no lesion (regression), 37.9% maintained CIN1, and 33.4% progressed to CIN2/3. Immunostaining for p16(INK) (4a) was performed in the first biopsy and it was considered positive when there was strong and diffuse staining of the basal and parabasal layers. Pearson's chi-square was used to compare the groups (p ≤ 0.05). The age of the patients was similar. There was no significant difference in p16(INK) (4a) immunoexpression in the groups, however, statistical analyses showed a significant association when only the progression and regression groups were compared (p = 0.042). Considering p16(INK) (4a) positivity and the progression to CIN2/3, the sensitivity, specificity, positive, and negative predictive values in our cohort were 45%, 75%, 47%, and 94%, respectively. We emphasize that CIN1 with p16(INK) (4a) staining was associated with lesion progression, but the sensitivity was not high. However, the negative predictive value was more reliable (94%) and p16(INK) (4a) may represent a useful biomarker that can identify CIN1 lesions that need particular attention, complementing morphology.

Rugosidade e pigmentação superficial de materiais ionoméricos

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Efeito de baixas doses de radiação X em feridas suturadas e não suturadas - estudo experimental em ratos

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Effect of ageing and immersion in different beverages on properties of denture lining materials

OBJECTIVES: To evaluate the color stability and hardness of two denture liners obtained by direct and indirect techniques, after thermal cycling and immersion in beverages that can cause staining of teeth. MATERIAL AND METHODS: Seventy disc-shaped specimens (18 x 3 mm) processed by direct (DT) and indirect techniques (IT) were made from Elite soft (n=35) and Kooliner (n=35) denture liners. For each material and technique, 10 specimens were subjected to thermal cycling (3,000 cycles) and 25 specimens were stored in water, coffee, tea, soda and red wine for 36 days. The values of color change, Shore A hardness (Elite soft) and Knoop hardness (Kooliner) were obtained. The data were subjected to ANOVA, Tukey's multiple-comparison test, and Kruskal-Wallis test (P<0.05). RESULTS: The thermal cycling promoted a decrease on hardness of Kooliner regardless of the technique used (Initial: 9.09± 1.61; Thermal cycling: 7.77± 1.47) and promoted an increase in the hardness in the DT for Elite Soft (Initial: 40.63± 1.07; Thermal cycling: 43.53± 1.03); hardness of Kooliner (DT: 8.76± 0.95; IT: 7.70± 1.62) and Elite Soft (DT: 42.75± 1.54; IT=39.30± 2.31) from the DT suffered an increase after the immersion in the beverages. The thermal cycling promoted color change only for Kooliner in the IT. Immersion in the beverages did not promote color change for Elite in both techniques. The control group of the DT of Kooliner showed a significant color change. Wine and coffee produced the greatest color change in the DT only for Elite Soft when compared to the other beverages. CONCLUSION: The three variation factors promoted alteration on hardness and color of the tested denture lining materials.

Influence of surface sealant on the translucency of composite resin: effect of immersion time and immersion media

This study evaluated the effect of surface sealant on the translucency of composite resin immersed in different solutions. The study involved the following materials: Charisma, Fortify and coffee, Coca-Cola®, tea and artificial saliva as solutions. Sixty-four specimens (n = 8) were manufactured and immersed in artificial saliva at 37 ± 1 °C. Samples were immersed in the solutions for three times a day and re-immersed in artificial saliva until the translucency readings. The measurements were carried out at nine times: T1 - 24 hours after specimen preparation, T2 - 24 hours after immersion in the solutions, T3 - 48 hours and T4 to T9 - 7, 14, 21, 30, 60 and 90 days, respectively, after immersion. The translucency values were measured using a JOUAN device. The results were subjected to ANOVA and Tukey's test at 5%. The surface sealant was not able to protect the composite resin against staining, the coffee showed the strongest staining action, followed by tea and regarding immersion time, a significant alteration was noted in the translucency of composite resin after 21 days.

Composite resin color stability: influence of light sources and immersion media

OBJECTIVE: This study evaluated the influence of light sources and immersion media on the color stability of a nanofilled composite resin. MATERIAL AND METHODS: Conventional halogen, high-power-density halogen and high-power-density light-emitting diode (LED) units were used. There were 4 immersion media: coffee, tea, Coke® and artificial saliva. A total of 180 specimens (10 mm x 2 mm) were prepared, immersed in artificial saliva for 24 h at 37±1ºC, and had their initial color measured with a spectrophotometer according to the CIELab system. Then, the specimens were immersed in the 4 media during 60 days. Data from the color change and luminosity were collected and subjected to statistical analysis by the Kruskall-Wallis test (p<0.05). For immersion time, the data were subjected to two-way ANOVA test and Fisher's test (p<0.05). RESULTS: High-power-density LED (ΔE=1.91) promoted similar color stability of the composite resin to that of the tested halogen curing units (Jet Lite 4000 plus - ΔE=2.05; XL 3000 - ΔE=2.28). Coffee (ΔE=8.40; ΔL=-5.21) showed the highest influence on color stability of the studied composite resin. CONCLUSION: There was no significant difference in color stability regardless of the light sources, and coffee was the immersion medium that promoted the highest color changes on the tested composite resin.

Vimentin expression and the influence of Matrigel in cell lines of head and neck squamous cell carcinoma

Vimentin is a cytoeskeletal intermediate filament protein commonly observed in mesenchymal cells; however, it can also be found in malignant epithelial cells. It is demonstrated in several carcinomas, such as those of the cervix, breast and bladder, in which it is widely used as a marker of the epithelial to mesenchymal transition that takes place during embryogenesis and metastasis. Vimentin is associated with tumors that show a high degree of invasiveness, being detected in invasion front cells. Its expression seems to be influenced by the tumor microenvironment. The aim of this study was to evaluate vimentin expression in head and neck squamous cell carcinoma (HNSCC) cell lines, and to investigate the contribution of the microenvironment to its expression. HNSCC cell lines (HN6, HN30 and HN31) and an immortalized nontumorigenic cell line (HaCaT) were submitted to a three-dimensional assay with Matrigel. Cytoplasmatic staining of the HN6 cell line cultured without Matrigel and of the HN30 and HN31 cell lines cultured with Matrigel was demonstrated through immunohistochemistry. Western Blotting revealed a significant decrease in vimentin expression for the HN6 cell line and a significant increase for the HN30 and HN31 cell lines cultured with Matrigel. The results suggest that vimentin can be expressed in HNSCC cells and its presence is influenced by the microenvironment of a tumor.

Histologic grading and nucleolar organizer regions in oral squamous cell carcinomas

OBJECTIVE: The purposes of this study were to histologically assess different types of oral squamous cell carcinoma and the silver-binding nucleolar organizer region (AgNOR) morphology in neoplastic cells, as well as to quantify the number of AgNORs in each type of carcinoma in order to relate AgNOR count and histologic grading. MATERIAL AND METHODS: Twenty-eight cases of oral squamous cell carcinoma were divided into 4 groups, namely well-differentiated, moderately differentiated, poorly differentiated, and undifferentiated. For NOR study, 3-µm-thick sections were stained with 50% aqueous silver nitrate solution. The predominant microscopic pattern of NORs was determined. Quantitative analyses of NORs were obtained of all cells present on each histological field using a 0.025 mm² eyepiece graticule. Different histological fields were analyzed until the total number of NORs was 120 cells for each tumor. Kruskall-Wallis test was applied to compare the groups of sample data at a significance level of p=0.05. RESULTS: The mean number of AgNORs per nucleus was 3.20 for the well-differentiated group, 5.33 for the moderately differentiated one, 8.27 for the poorly differentiated one, and 10.08 for the undifferentiated one. AgNOR count was significantly different (p<0.05) among all of the studied groups. CONCLUSION: AgNOR staining technique seems to be a useful diagnostic tool since differences in AgNOR numeric values can be identified in the different types of oral squamous cell carcinoma. This technique is easy to handle and inexpensive, thus justifying its large use in histopathology.

Alterações do trato digestório de cães da raça Golden Retriever afetados pela distrofia muscular

O modelo experimental canino Golden Retriever portador da Distrofia Muscular (GRMD) é o melhor substituto entre os modelos animais para estudar a Distrofia Muscular de Duchenne. Além da musculatura estriada, a doença pode afetar a musculatura estriada cardíaca e a musculatura lisa, e desta forma, o funcionamento do trato digestório, já que o músculo liso é o elemento primário dos órgãos tubulares. Através de estudo morfológico descritivo, o objetivo deste trabalho foi verificar se a distrofia muscular afeta a arquitetura geral do trato digestório e como se dispõe sua estrutura muscular em animais afetados. Foram realizadas avaliações descritivas macro e microscópicas com colorações de Hematoxilina-Eosina, Tricrômio de Masson e Picrosirius. Entre os resultados apresentados, verificou-se que o esôfago e o fígado dos animais afetados encontraram-se alterados, assim como o estômago não ocupava seu lugar habitual. O músculo diafragma apresentava-se atrofiado e diferenças histológicas foram encontradas na camada muscular do sistema gastrointestinal, em geral. Outras estruturas do tubo digestório de GRMDs apresentaram-se de maneira similar a de um animal normal.