916 resultados para Stratigraphic sequence


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A limited number of plant rhabdovirus genomes have been fully sequenced, making taxonomic classification, evolutionary analysis and molecular characterization of this virus group difficult. We have for the first time determined the complete genome sequence of 13,188 nucleotides of Datura yellow vein nucleorhabdovirus (DYVV). DYVV genome organization resembles that of its closest relative, Sonchus yellow net virus (SYNV), with six ORFs in antigenomic orientation, separated by highly conserved intergenic regions and flanked by complementary 3′ leader and 5′ trailer sequences. As is typical for nucleorhabdoviruses, all viral proteins, except the glycoprotein, which is targeted to the endoplasmic reticulum, are localized to the nucleus. Nucleocapsid (N) protein, matrix (M) protein and polymerase, as components of nuclear viroplasms during replication, have predicted strong canonical nuclear localization signals, and N and M proteins exclusively localize to the nucleus when transiently expressed as GFP fusions. As in all nucleorhabdoviruses studied so far, N and phosphoprotein P interact when co-expressed, significantly increasing P nuclear localization in the presence of N protein. This research adds to the list of complete genomes of plant-infecting rhabdoviruses, provides molecular tools for further characterization and supports classification of DYVV as a nucleorhabdovirus closely related to but with some distinct differences from SYNV.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Mango fruits contain a broad spectrum of phenolic compounds which impart potential health benefits; their biosynthesis is catalysed by enzymes in the phenylpropanoid-flavonoid (PF) pathway. The aim of this study was to reveal the variability in genes involved in the PF pathway in three different mango varieties Mangifera indica L., a member of the family Anacardiaceae: Kensington Pride (KP), Irwin (IW) and Nam Doc Mai (NDM) and to determine associations with gene expression and mango flavonoid profiles. Results: A close evolutionary relationship between mango genes and those from the woody species poplar of the Salicaceae family (Populus trichocarpa) and grape of the Vitaceae family (Vitis vinifera), was revealed through phylogenetic analysis of PF pathway genes. We discovered 145 SNPs in total within coding sequences with an average frequency of one SNP every 316bp. Variety IW had the highest SNP frequency (one SNP every 258bp) while KP and NDM had similar frequencies (one SNP every 369bp and 360bp, respectively). The position in the PF pathway appeared to influence the extent of genetic diversity of the encoded enzymes. The entry point enzymes phenylalanine lyase (PAL), cinnamate 4-mono-oxygenase (C4H) and chalcone synthase (CHS) had low levels of SNP diversity in their coding sequences, whereas anthocyanidin reductase (ANR) showed the highest SNP frequency followed by flavonoid 3'-hydroxylase (F3'H). Quantitative PCR revealed characteristic patterns of gene expression that differed between mango peel and flesh, and between varieties. Conclusions: The combination of mango expressed sequence tags and availability of well-established reference PF biosynthetic genes from other plant species allowed the identification of coding sequences of genes that may lead to the formation of important flavonoid compounds in mango fruits and facilitated characterisation of single nucleotide polymorphisms between varieties. We discovered an association between the extent of sequence variation and position in the pathway for up-stream genes. The high expression of PAL, C4H and CHS genes in mango peel compared to flesh is associated with high amounts of total phenolic contents in peels, which suggest that these genes have an influence on total flavonoid levels in mango fruit peel and flesh. In addition, the particularly high expression levels of ANR in KP and NDM peels compared to IW peel and the significant accumulation of its product epicatechin gallate (ECG) in those extracts reflects the rate-limiting role of ANR on ECG biosynthesis in mango. © 2015 Hoang et al.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Expressed sequence tag (EST) databases provide a primary source of nuclear DNA sequences for genetic marker development in non-model organisms. To date, the process has been relatively inefficient for several reasons: - 1) priming site polymorphism in the template leads to inferior or erratic amplification; - 2) introns in the target amplicon are too large and/or numerous to allow effective amplification under standard screening conditions, and; - 3) at least occasionally, a PCR primer straddles an exon–intron junction and is unable to bind to genomic DNA template. The first is only a minor issue for species or strains with low heterozygosity but becomes a significant problem for species with high genomic variation, such as marine organisms with extremely large effective population sizes. Problems arising from unanticipated introns are unavoidable but are most pronounced in intron-rich species, such as vertebrates and lophotrochozoans. We present an approach to marker development in the Pacific oyster Crassostrea gigas, a highly polymorphic and intron-rich species, which minimizes these problems, and should be applicable to other non-model species for which EST databases are available. Placement of PCR primers in the 3′ end of coding sequence and 3′ UTR improved PCR success rate from 51% to 97%. Almost all (37 of 39) markers developed for the Pacific oyster were polymorphic in a small test panel of wild and domesticated oysters.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The analysis of sequential data is required in many diverse areas such as telecommunications, stock market analysis, and bioinformatics. A basic problem related to the analysis of sequential data is the sequence segmentation problem. A sequence segmentation is a partition of the sequence into a number of non-overlapping segments that cover all data points, such that each segment is as homogeneous as possible. This problem can be solved optimally using a standard dynamic programming algorithm. In the first part of the thesis, we present a new approximation algorithm for the sequence segmentation problem. This algorithm has smaller running time than the optimal dynamic programming algorithm, while it has bounded approximation ratio. The basic idea is to divide the input sequence into subsequences, solve the problem optimally in each subsequence, and then appropriately combine the solutions to the subproblems into one final solution. In the second part of the thesis, we study alternative segmentation models that are devised to better fit the data. More specifically, we focus on clustered segmentations and segmentations with rearrangements. While in the standard segmentation of a multidimensional sequence all dimensions share the same segment boundaries, in a clustered segmentation the multidimensional sequence is segmented in such a way that dimensions are allowed to form clusters. Each cluster of dimensions is then segmented separately. We formally define the problem of clustered segmentations and we experimentally show that segmenting sequences using this segmentation model, leads to solutions with smaller error for the same model cost. Segmentation with rearrangements is a novel variation to the segmentation problem: in addition to partitioning the sequence we also seek to apply a limited amount of reordering, so that the overall representation error is minimized. We formulate the problem of segmentation with rearrangements and we show that it is an NP-hard problem to solve or even to approximate. We devise effective algorithms for the proposed problem, combining ideas from dynamic programming and outlier detection algorithms in sequences. In the final part of the thesis, we discuss the problem of aggregating results of segmentation algorithms on the same set of data points. In this case, we are interested in producing a partitioning of the data that agrees as much as possible with the input partitions. We show that this problem can be solved optimally in polynomial time using dynamic programming. Furthermore, we show that not all data points are candidates for segment boundaries in the optimal solution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The H1',H2' and H2″ regions of the 270-MHz PMR spectra of two deoxydinucleotides, d-pTpA and d-pApT, have been analyzed. The coupling constants in the sugar ring indicate that both A and T sugars have a tendency to acquire 2E conformations. There is also a marginal difference in the 2E populations of the T sugar in the two dinucleotides. The trends in the chemical shifts of base protons indicate different stacking of the bases in d-pApT and d-pTpA. The sequence effects on base stacking and pentose conformation are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.