999 resultados para Histopathological evaluation


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sunlight exposure causes several types of injury to humans, especially on the skin; among the most common harmful effects due to ultraviolet (UV) exposure are erythema, pigmentation and lesions in DNA, which may lead to cancer. These long-term effects are minimized with the use of sunscreens, a class of cosmetic products that contains UV filters as the main component in the formulation; such molecules can absorb, reflect or diffuse UV rays, and can be used alone or as a combination to broaden the protection on different wavelengths. Currently, worldwide regulatory agencies define which ingredients and what quantities must be used in each country, and enforce companies to conduct tests that confirm the Sun Protection Factor (SPF) and the UVA (Ultraviolet A) factor. Standard SPF determination tests are currently conducted in vivo, using human subjects. In an industrial mindset, apart from economic and ethical reasons, the introduction of an in vitro method emerges as an interesting alternative by reducing risks associated to UV exposure on tests, as well as providing assertive analytical results. The present work aims to describe a novel methodology for SPF determination directly from sunscreen formulations using the previously described cosmetomics platform and mass spectrometry as the analytical methods of choice.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To identify the prevalence and the severity of malocclusions and to analyze factors associated with the need for orthodontic treatment of Brazilian adolescents. This exploratory, cross-sectional study was carried out based on secondary data from the national epidemiological survey on oral health in Brazil (2002-2003). Socio-demographic conditions, self-perception, and the existence and degree of malocclusion, using the Dental Aesthetic Index, were evaluated in 16,833 adolescent Brazilians selected by probabilistic sample by conglomerates. The dependent variable - need orthodontic treatment - was estimated from the severity of malocclusion. The magnitude and direction of the association in bivariate and multivariate analyzes from a Robust Poisson regression was estimated RESULTS: The majority of the adolescents needed orthodontic treatment (53.2%). In the multivariate analysis, the prevalence of the need for orthodontic treatment was larger among females, non-whites, those that perceived a need for treatment, and those that perceived their appearance as normal, bad, or very bad. The need for orthodontic treatment was smaller among those that lived in the Northeast and Central West macro-regions compared to those living in Southeast Brazil and it was also smaller among those that perceived their chewing to be normal or their oral health to be bad or very bad. There was a high prevalence of orthodontic treatment need among adolescents in Brazil and this need was associated with demographic and subjective issues. The high prevalence of orthodontic needs in adolescents is a challenge to the goals of Brazil's universal public health system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to correlate the pre-operative imaging, vascularity of the proximal pole, and histology of the proximal pole bone of established scaphoid fracture non-union. This was a prospective non-controlled experimental study. Patients were evaluated pre-operatively for necrosis of the proximal scaphoid fragment by radiography, computed tomography (CT) and magnetic resonance imaging (MRI). Vascular status of the proximal scaphoid was determined intra-operatively, demonstrating the presence or absence of puncate bone bleeding. Samples were harvested from the proximal scaphoid fragment and sent for pathological examination. We determined the association between the imaging and intra-operative examination and histological findings. We evaluated 19 male patients diagnosed with scaphoid nonunion. CT evaluation showed no correlation to scaphoid proximal fragment necrosis. MRI showed marked low signal intensity on T1-weighted images that confirmed the histological diagnosis of necrosis in the proximal scaphoid fragment in all patients. Intra-operative assessment showed that 90% of bones had absence of intra-operative puncate bone bleeding, which was confirmed necrosis by microscopic examination. In scaphoid nonunion MRI images with marked low signal intensity on T1-weighted images and the absence of intra-operative puncate bone bleeding are strong indicatives of osteonecrosis of the proximal fragment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We studied the clinical aspects of 100 consecutive premature newborns with and without intraventricular and periventricular hemorrhage (IPVH).The diagnosis of IPVH was obtained by ultrasonic scans of the skull during the first week of life and at the age of one month. Forty eight percent of newborns with IPVH had abnormal results, and there was a significant correlation with the neurological evaluation in 85% of the infants. The probability of normality for a child with no associated brain abnormalities was 72%, whereas for a child of the same gestational age with associated brain abnormalities was 48.7%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To describe the role of magnetic resonance imaging (MRI) in the evaluation of patients with chronic and recurrent aseptic meningitis.METHOD: A retrospective study of five patients with aseptic meningoencefalitis diagnosed by clinical and CSF findings. CT scans showed without no relevant findings. RESULTS: MRI showed small multifocal lesions hyperintense on T2 weighted images and FLAIR, with mild or no gadolinium enhancement, mainly in periventricular and subcortical regions. Meningoencephalitis preceded the diagnosis of the underlying disease in four patients (Behçet´s disease or systemic lupus erythematosus). After the introduction of adequate treatment for the rheumatic disease, they did not present further symptoms of aseptic meningoencephalitis. CONCLUSION: Aseptic meningoencephalitis can be an early presentation of an autoimmune disease. It is important to emphasize the role of MRI in the diagnosis and follow-up of these patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study evaluated two cases of Apert's syndrome, through phonological, cognitive, and neuropsychological instruments and correlated the results to complementary exams. In short, this study reveals the necessity of application of neuropsychological, cognitive and phonological evaluation and correlation of the results with complementary testings because significant differences can be present in the Apert's syndrome.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To evaluate insulin resistance and lipid profile in women with congenital adrenal hyperplasia (CAH) caused by classical 21-hydroxylase deficiency (21OHD), and their association with body mass index (BMI) and corticosteroid dosage. SUBJECTS AND METHODS: We assessed BMI, waist circumference, current glucocorticoid dosage, glucose, insulin and lipid profile in eighteen young women (mean ± SD, 19.3 ± 3.0 years) with 21OHD CAH. RESULTS: BMI was normal in 12 patients, 5 of them were overweight, and 1 was obese. Waist circumference was high in 7 patients. Fasting insulin and HOMA-IR were elevated in seven and eight patients, respectively. Total cholesterol and triglycerides were high in only two patients, and HDL-cholesterol was low in four. Insulin resistance was not associated with BMI, waist circumference or glucocorticoid dose. CONCLUSIONS: Young women with 21OHD CAH had infrequent dyslipidemia, but had a higher prevalence of insulin resistance and central obesity, that were independent of BMI or corticosteroid dosage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: This study evaluated the quality of DNA obtained from stored human saliva and its applicability to human identification. METHODS: The saliva samples of 20 subjects, collected in the form of saliva in natura and from mouth swabs and stored at -20ºC, were analyzed. After 7 days, the DNA was extracted from the 40 saliva samples and subjected to PCR and electrophoresis. After 180 days, the technique was repeated with the 20 swab samples. RESULTS: The first-stage results indicated that DNA was successfully extracted in 97.5% of reactions, 95% of saliva in natura and 100% of swab saliva samples, with no statistically significant difference between the forms of saliva. In the second phase, the result was positive for all 20 analyzed samples (100%). Subsequently, in order to analyze the quality of the DNA obtained from human saliva, the SIX3-2 gene was tested on the 20 mouth swab samples, and the PCR products were digested using the MbO1 restriction enzyme to evaluate polymorphisms in the ADRA-2 gene, with positive results for most samples. CONCLUSION: It was concluded that the quantity and quality of DNA from saliva and the techniques employed are adequate for forensic analysis of DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Despite the advances in bonding materials, many clinicians today still prefer to place bands on molar teeth. Molar bonding procedures need improvement to be widely accepted clinically. OBJECTIVE: The purpose of this study was to evaluate the shear bond strength when an additional adhesive layer was applied on the occlusal tooth/tube interface to provide reinforcement to molar tubes. MATERIAL AND METHODS: Sixty third molars were selected and allocated to the 3 groups: group 1 received a conventional direct bond followed by the application of an additional layer of adhesive on the occlusal tooth/tube interface, group 2 received a conventional direct bond, and group 3 received a conventional direct bond and an additional cure time of 10 s. The specimens were debonded in a universal testing machine. The results were analyzed statistically by ANOVA and Tukey's test (α=0.05). RESULTS: Group 1 had a significantly higher (p<0.05) shear bond strength compared to groups 2 and 3. No difference was detected between groups 2 and 3 (p>0.05). CONCLUSIONS: The present in vitro findings indicate that the application of an additional layer of adhesive on the tooth/tube interface increased the shear bond strength of the bonded molar tubes.