Standardized reporting using CODES (Crash Outcome Data Evaluation System).

National Highway Traffic Safety Administration, Washington, D.C.

Error-correcting codes on a Bethe-like lattice

We analyse Gallager codes by employing a simple mean-field approximation that distorts the model geometry and preserves important interactions between sites. The method naturally recovers the probability propagation decoding algorithm as a minimization of a proper free-energy. We find a thermodynamical phase transition that coincides with information theoretical upper-bounds and explain the practical code performance in terms of the free-energy landscape.

Statistical mechanics of broadcast channels using low-density parity-check codes

We investigate the use of Gallager's low-density parity-check (LDPC) codes in a degraded broadcast channel, one of the fundamental models in network information theory. Combining linear codes is a standard technique in practical network communication schemes and is known to provide better performance than simple time sharing methods when algebraic codes are used. The statistical physics based analysis shows that the practical performance of the suggested method, achieved by employing the belief propagation algorithm, is superior to that of LDPC based time sharing codes while the best performance, when received transmissions are optimally decoded, is bounded by the time sharing limit.

Theoretical study of Talbot-like bands observed using a laser diode below threshold

We report on a theoretical study of an interferometric system in which half of a collimated beam from a broadband optical source is intercepted by a glass slide, the whole beam subsequently being incident on a diffraction grating and the resulting spectrum being viewed using a linear CCD array. Using Fourier theory, we derive the expression of the intensity distribution across the CCD array. This expression is then examined for non-cavity and cavity sources for different cases determined by the direction from which the slide is inserted into the beam and the source bandwidth. The theoretical model shows that the narrower the source linewidth, the higher the deviation of the Talbot bands' visibility (as it is dependent on the path imbalance) from the previously known triangular shape. When the source is a laser diode below threshold, the structure of the CCD signal spectrum is very complex. The number of components present simultaneously increases with the number of grating lines and decreases with the laser cavity length. The model also predicts the appearance of bands in situations not usually associated with Talbot bands.

Theoretical study of Talbot-like bands observed using a laser diode below threshold

We report on a theoretical study of an interferometric system in which half of a collimated beam from a broadband optical source is intercepted by a glass slide, the whole beam subsequently being incident on a diffraction grating and the resulting spectrum being viewed using a linear CCD array. Using Fourier theory, we derive the expression of the intensity distribution across the CCD array. This expression is then examined for non-cavity and cavity sources for different cases determined by the direction from which the slide is inserted into the beam and the source bandwidth. The theoretical model shows that the narrower the source linewidth, the higher the deviation of the Talbot bands' visibility (as it is dependent on the path imbalance) from the previously known triangular shape. When the source is a laser diode below threshold, the structure of the CCD signal spectrum is very complex. The number of components present simultaneously increases with the number of grating lines and decreases with the laser cavity length. The model also predicts the appearance of bands in situations not usually associated with Talbot bands.

Interleavers and BCH codes for coherent DQPSK systems with laser phase noise

The relatively high phase noise of coherent optical systems poses unique challenges for forward error correction (FEC). In this letter, we propose a novel semianalytical method for selecting combinations of interleaver lengths and binary Bose-Chaudhuri-Hocquenghem (BCH) codes that meet a target post-FEC bit error rate (BER). Our method requires only short pre-FEC simulations, based on which we design interleavers and codes analytically. It is applicable to pre-FEC BER ∼10-3, and any post-FEC BER. In addition, we show that there is a tradeoff between code overhead and interleaver delay. Finally, for a target of 10-5, numerical simulations show that interleaver-code combinations selected using our method have post-FEC BER around 2× target. The target BER is achieved with 0.1 dB extra signal-to-noise ratio.

The evolutionary relationships and age of Homo naledi : an assessment using dated Bayesian phylogenetic methods

Acknowledgements We wish to express our gratitude to the National Geographic Society and the National Research Foundation of South Africa for funding the discovery, recovery, and analysis of the H. naledi material. The study reported here was also made possible by grants from the Social Sciences and Humanities Research Council of Canada, the Canada Foundation for Innovation, the British Columbia Knowledge Development Fund, the Canada Research Chairs Program, Simon Fraser University, the DST/NRF Centre of Excellence in Palaeosciences (COE-Pal), as well as by a Discovery Grant from the Natural Sciences and Engineering Research Council of Canada, a Young Scientist Development Grant from the Paleontological Scientific Trust (PAST), a Baldwin Fellowship from the L.S.B. Leakey Foundation, and a Seed Grant and a Cornerstone Faculty Fellowship from the Texas A&M University College of Liberal Arts. We would like to thank the South African Heritage Resource Agency for the permits necessary to work on the Rising Star site; the Jacobs family for granting access; Wilma Lawrence, Bonita De Klerk, Merrill Van der Walt, and Justin Mukanku for their assistance during all phases of the project; Lucas Delezene for valuable discussion on the dental characters of H. naledi. We would also like to thank Peter Schmid for the preparation of the Dinaledi fossil material; Yoel Rak for explaining in detail some of the characters used in previous studies; William Kimbel for drawing our attention to the possibility that there might be a problem with Dembo et al.’s (2015) codes for the two characters related to the articular eminence; Will Stein for helpful discussion about the Bayesian analyses; Mike Lee for his comments on this manuscript; John Hawks for his support in organizing the Rising Star workshop; and the associate editor and three anonymous reviewers for their valuable comments. We are grateful to S. Potze and the Ditsong Museum, B. Billings and the School of Anatomical Sciences at the University of the Witwatersrand, and B. Zipfel and the Evolutionary Studies Institute at the University of the Witwatersrand for providing access to the specimens in their care; the University of the Witwatersrand, the Evolutionary Studies Institute, and the South African National Centre of Excellence in PalaeoSciences for hosting a number of the authors while studying the material; and the Western Canada Research Grid for providing access to the high-performance computing facilities for the Bayesian analyses. Last but definitely not least, we thank the head of the Rising Star project, Lee Berger, for his leadership and support, and for encouraging us to pursue the study reported here.

Benchmarking a modified version of the civ3 nonrelativistic atomic-structure code within Na-like-tungsten R -matrix calculations

In this work we explore the validity of employing a modified version of the nonrelativistic structure code civ3 for heavy, highly charged systems, using Na-like tungsten as a simple benchmark. Consequently, we present radiative and subsequent collisional atomic data compared with corresponding results from a fully relativistic structure and collisional model. Our motivation for this line of study is to benchmark civ3 against the relativistic grasp0 structure code. This is an important study as civ3 wave functions in nonrelativistic R-matrix calculations are computationally less expensive than their Dirac counterparts. There are very few existing data for the W LXIV ion in the literature with which we can compare except for an incomplete set of energy levels available from the NIST database. The overall accuracy of the present results is thus determined by the comparison between the civ3 and grasp0 structure codes alongside collisional atomic data computed by the R-matrix Breit-Pauli and Dirac codes. It is found that the electron-impact collision strengths and effective collision strengths computed by these differing methods are in good general agreement for the majority of the transitions considered, across a broad range of electron temperatures.

Efficient removal of paracetamol using LaCu1-xMxO3 (M=Mn, Ti) perovskites as heterogeneous Fenton-like catalysts

A series of perovskite-like oxides LaCu1-xMxO3 (M=Mn, Ti; 0.0 ⩽ x ⩽ 0.8) was prepared by amorphous citrate decomposition and characterized by XRD, ICP-OES and XPS techniques. The catalysts were tested in the Fenton-like degradation of paracetamol with H2O2, under mild reaction conditions, 25 °C and nearly neutral pH. Values of decomposition of paracetamol between 80 and 97% at 300 min were achieved for most of samples. The presence of the Cu2+/Cu+ pair at the surface of the catalysts is necessary to carry out the reaction and the catalysts containing higher amount of copper at the surface, resulted to be more active. The leaching of metals was less than 1%, which discards the contribution of the homogenous Fenton-like reaction and remarks the high stability of the metals into the mixed oxide network. The catalytic activity of LaCu0.8Mn0.2O3 was maintained after three cycles of reaction, which proves the stability and reusability of the catalyst.

Anxiety-like Effects Of Meta-chlorophenylpiperazine In Paradoxically Sleep-deprived Mice.

Chlorophenylpiperazines (CPP) are psychotropic drugs used in nightclub parties and are frequently used in a state of sleep deprivation, a condition which can potentiate the effects of psychoactive drugs. This study aimed to investigate the effects of sleep deprivation and sleep rebound (RB) on anxiety-like measures in mCPP-treated mice using the open field test. We first optimized our procedure by performing dose-effect curves and examining different pretreatment times in naïve male Swiss mice. Subsequently, a separate cohort of mice underwent paradoxical sleep deprivation (PSD) for 24 or 48h. In the last experiment, immediately after the 24h-PSD period, mice received an injection of saline or mCPP, but their general activity was quantified in the open field only after the RB period (24 or 48h). The dose of 5mgmL(-1) of mCPP was the most effective at decreasing rearing behavior, with peak effects 15min after injection. PSD decreased locomotion and rearing behaviors, thereby inhibiting a further impairment induced by mCPP. Plasma concentrations of mCPP were significantly higher in PSD 48h animals compared to the non-PSD control group. Twenty-four hours of RB combined with mCPP administration produced a slight reduction in locomotion. Our results show that mCPP was able to significantly change the behavior of naïve, PSD, and RB mice. When combined with sleep deprivation, there was a higher availability of drug in plasma levels. Taken together, our results suggest that sleep loss can enhance the behavioral effects of the potent psychoactive drug, mCPP, even after a period of rebound sleep.

Geographical Distribution Of The Association Between El Niño South Oscillation And Dengue Fever In The Americas: A Continental Analysis Using Geographical Information System-based Techniques.

El Niño South Oscillation (ENSO) is one climatic phenomenon related to the inter-annual variability of global meteorological patterns influencing sea surface temperature and rainfall variability. It influences human health indirectly through extreme temperature and moisture conditions that may accelerate the spread of some vector-borne viral diseases, like dengue fever (DF). This work examines the spatial distribution of association between ENSO and DF in the countries of the Americas during 1995-2004, which includes the 1997-1998 El Niño, one of the most important climatic events of 20(th) century. Data regarding the South Oscillation index (SOI), indicating El Niño-La Niña activity, were obtained from Australian Bureau of Meteorology. The annual DF incidence (AIy) by country was computed using Pan-American Health Association data. SOI and AIy values were standardised as deviations from the mean and plotted in bars-line graphics. The regression coefficient values between SOI and AIy (rSOI,AI) were calculated and spatially interpolated by an inverse distance weighted algorithm. The results indicate that among the five years registering high number of cases (1998, 2002, 2001, 2003 and 1997), four had El Niño activity. In the southern hemisphere, the annual spatial weighted mean centre of epidemics moved southward, from 6° 31' S in 1995 to 21° 12' S in 1999 and the rSOI,AI values were negative in Cuba, Belize, Guyana and Costa Rica, indicating a synchrony between higher DF incidence rates and a higher El Niño activity. The rSOI,AI map allows visualisation of a graded surface with higher values of ENSO-DF associations for Mexico, Central America, northern Caribbean islands and the extreme north-northwest of South America.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Induction of a gloverin-like antimicrobial polypeptide in the sugarcane borer Diatraea saccharalis challenged by septic injury

Diatraea saccharalis (Fabricius, 1794) (Lepidoptera: Crambidae) is an important pest for Brazilian sugarcane. In the present study, we detected two distinct spots in hemolymph from septic injured larvae (HDs1 and HDs2), which are separated by 2DE gel electrophoresis. Both spots were subjected to in-gel tryptic digestion and MALDI-TOF/TOF analysis, which revealed the sequence VFGTLGSDDSGLFGK present in both HDs1 and HDs2. This sequence had homology and 80% identity with specific Lepidoptera antimicrobial peptides called gloverins. Analyses using the ImageMaster 2D software showed pI 8.94 of the HDs1 spot, which is similar to that described to Hyalophora gloveri gloverin (pI 8.5). Moreover, the 14-kDa molecular mass of the spot HDs1 is compatible to that of gloverins isolated from the hemolymph of Trichoplusia ni, Helicoverpa armigera and H. gloveri. Antimicrobial assays with partially purified fractions containing the HDs1 and HDs2 polypeptides demonstrated activity against Escherichia coli. This is the first report of antimicrobial polypeptides in D. saccharalis, and the identification of these peptides may help in the generation of new strategies to control this pest.

Keratoconus prediction using a finite element model of the cornea with local biomechanical properties

PURPOSE: The ability to predict and understand which biomechanical properties of the cornea are responsible for the stability or progression of keratoconus may be an important clinical and surgical tool for the eye-care professional. We have developed a finite element model of the cornea, that tries to predicts keratoconus-like behavior and its evolution based on material properties of the corneal tissue. METHODS: Corneal material properties were modeled using bibliographic data and corneal topography was based on literature values from a schematic eye model. Commercial software was used to simulate mechanical and surface properties when the cornea was subject to different local parameters, such as elasticity. RESULTS: The simulation has shown that, depending on the corneal initial surface shape, changes in local material properties and also different intraocular pressures values induce a localized protuberance and increase in curvature when compared to the remaining portion of the cornea. CONCLUSIONS: This technique provides a quantitative and accurate approach to the problem of understanding the biomechanical nature of keratoconus. The implemented model has shown that changes in local material properties of the cornea and intraocular pressure are intrinsically related to keratoconus pathology and its shape/curvature.