Lipopolysaccharide and lipoteichoic acid induce different innate immune responses in bovine mammary epithelial cells

The objective of the present study was to characterize the innate immune responses induced by in vitro stimulation of bovine primary mammary epithelial cells (bMEC) using gram-negative lipopolysaccharide (LPS) and gram-positive lipoteichoic acid (LTA) bacterial cell wall components. Quantitative real-time PCR (qRT-PCR) was employed to examine the mRNA expression of a panel of 22 cytokines, chemokines, beta-defensins and components of the Toll-Like Receptor signaling pathway. Stimulation of bMEC with LPS for 24 h elicited a marked increase in mRNA expression for IL-1 beta, IL-8, TNF alpha, CXCL6 and beta-defensin while members of the Toll-Like Receptor pathway.. although present, were largely unaffected. Surprisingly, stimulation of these cells with LTA for 24 h did not significantly alter the expression of these genes. A time course of the expression of IL-1 beta, IL-8, TNF alpha, CXCL6 and beta-defensin was subsequently performed. The mRNA levels of all genes increased rapidly after stimulation for 2-4 h with both LPS and LTA but only the former treatment resulted in sustained responses. In contrast, the increased gene expression for LTA stimulated cells returned to resting levels after 8-16 h with the exception of beta-defensin, which remained up-regulated. The limited and unsustained cytokine response to LTA may explain why mastitis caused by gram-positive bacteria has greater potential for chronic intra-mammary infection than gram-negative infection. It was concluded that bovine mammary epithelial cells have a strong but differential capacity to mount innate immune responses to bacterial cell wall components. Crown Copyright (c) 2005 Published by Elsevier Ltd. All rights reserved.

Effect of hypothalamo-pituitary disconnection on the development of anterior pituitary cells in late gestation ovine fetuses

The specific role of the hypothalamus in regulating the developmental profile of anterior pituitary (AP) cells remains largely unknown. The present study evaluated hypothalamic contributions to AP cell development, utilizing the technique of hypothalamo-pituitary disconnection (HPD). HPD of fetal sheep or sham surgery was performed at 110 days gestation (d) (n=6 each group; term ~ 147d). Fetuses were removed and pituitaries collected at 110d (no surgery; n=6) or 141d (sham and HPD groups). The impact of HPD on AP cell development was assessed by single-labeled immunofluorescence for five hormones to identify proportions of AP cells expressing each hormone. HPD was associated with a 70% increase (P

Giant protein kinases: Domain interactions and structural basis of autoregulation

The myosin-associated giant protein kinases twitchin and titin are composed predominantly of fibronectin- and immunoglobulin-like modules, We report the crystal structures of two autoinhibited twitchin kinase fragments, one from Aplysia and a larger fragment from Caenorhabditis elegans containing an additional C-terminal immunoglobulin-like domain, The structure of the longer fragment shoes that the immunoglobulin domain contacts the protein kinase domain on the opposite side from the catalytic cleft, laterally exposing potential myosin binding residues, Together, the structures reveal the cooperative interactions between the autoregulatory region and the residues from the catalytic domain involved in protein substrate binding, ATP binding, catalysis and the activation loop, and explain the differences between the observed autoinhibitory mechanism and the one found in the structure of calmodulin-dependent kinase I.

Binding and internalization of the melanocyte stimulating hormone receptor ligand [Nle(4), D-Phe(7)]alpha-MSH in B16 melanoma cells

The current study aims to ascertain the fate of the melanocyte stimulating hormone (MSH) receptor and its ligand [Nle(4), D-Phe(7)]alpha-MsH (NDP-MSH) following binding to murine B16 melanoma cells. Cells were incubated with [I-125]-NDP-MSH for up to 180 min and binding, internalization and degradation determined. Intracellular trafficking of the radiolabel was assessed !using Percoll density gradient centrifugation of homogenized cells. Receptor down-regulation and receptor mRNA levels were also measured over 96 hr after exposure to 1 mu M ligand. NDP-MSH accumulation increased with time in a temperature-dependent manner and was inhibited by excess peptide. The ligand was rapidly internalized and translocated to the lysosomal compartment where it was degraded. Internalization was accompanied by a loss or down-regulation of cell surface receptors, suggesting internalization of the NDP-MSH-receptor complex. No recycling of the receptors between the plasma membrane and intracellular compartments could be detected in this cell-hue. Approximately 15% of the surface receptors were resistant to down-regulation, possibly indicating receptor heterogeneity. Down-regulation persisted ibr up to 96 hr and was accompanied by a decrease in MSH receptor mRNA levels 48 hr after treatment. However, before this time, transcript levels were the same in treated and control cells. In contrast to what was seen with NDP-MSH, cell surface receptors removed with trypsin wc:re rapidly replaced. These results show that NDP-MSH not only induced MSH receptor :internalization but also inhibited receptor turnover, resulting in a prolonged down-regulation. It is concluded that, in B16 cells, the MSH receptor undergoes ligand-dependent internalization, resulting in a prolonged down-regulation. Copyright (C) 1996 Elsevier Science Ltd

Identification of intracellular and extracellular domains mediating signal transduction in the inhibitory glycine receptor chloride channel

Fast synaptic neurotransmission is mediated by transmitter-activated conformational changes in ligand-gated ion channel receptors, culminating in opening of the integral ion channel pore. Human hereditary hyperekplexia, or startle disease, is caused by mutations in both the intracellular or extracellular loops flanking the pore-lining M2 domain of the glycine receptor alpha 1 subunit. These flanking domains are designated the M1-M2 loop and the M2-M3 loop respectively. We show that four startle disease mutations and six additional alanine substitution mutations distributed throughout both loops result in uncoupling of the ligand binding sites from the channel activation gate. We therefore conclude that the M1-M2 and M2-M3 loops act in parallel to activate the channel. Their locations strongly suggest that they act as hinges governing allosteric control of the M2 domain. As the members of the ligand-gated ion channel superfamily share a common structure, this signal transduction model may apply to all members of this superfamily.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Estradiol`s Salutary Effects on Keratinocytes Following Trauma-Hemorrhage Are Mediated by Estrogen Receptor (ER)-alpha and ER-beta

Although administration of 17 beta-estradiol (estrogen) following trauma-hemorrhage attenuates the elevation of cytokine production and mitogen-activated protein kinase (MAPK) activation in epidermal keratinocytes, whether the salutary effects of estrogen are mediated by estrogen receptor (ER)-alpha. or ER-beta is not known. To determine which estrogen receptor is the mediator, we subjected C3H/HeN male mice to trauma-hemorrhage (2-cm midline laparotomy and bleeding of the animals to a mean blood pressure of 35 mmHg and maintaining that pressure for 90 min) followed by resuscitation with Ringer`s lactate (four times the shed blood volume) At the middle of resuscitation we subcutaneously injected ER-alpha agonist propyl pyrazole trial (PPT; 5 mu g/kg), ER-beta agonist diarylpropionitrile (DPN; 5 mu g/kg), estrogen (50 mu g/kg), or ER antagonist ICI 182,780 (150 mu g/kg). Two hours after resuscitation, we isolated keratinocytes, stimulated them with lipopolysaccharide for 24 In (5 mu g/mL for maximum cytokine production), and measured the production of interleukin (IL)-6, IL-10, IL-12, and INF-alpha and the activation of MAPK. Keratinocyte cytokine production markedly increased and MAPK activation occurred following trauma-hemorrhage but were normalized by administration of estrogen, PPT and DPN. PPT and DPN administration were equally effective in normalizing the inflammatory response of keratinocytes, indicating that both ER-alpha. and ER-beta mediate the salutary effects of estrogen on kerotinocytes after trauma-hemorrhage.

Drugs in the acute porphyrias - Toxicogenetic diseases

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.

Neutrophils recruitment during sepsis: Critical points and crossroads

The mechanisms that initiate an inflammatory systemic response to a bacterial infection lead to a high mortality and constitute the first cause of death in Critical Care Units (ICU`s). Sepsis is a poorly understood disease and despite life support techniques and the administration of antibiotics, not much more can be done to improve its diagnosis and treatment. The present article has as main objective to discuss the role of neutrophils recruitment in sepsis, dissecting the molecular mechanisms implicated in this complex process and its importance to the pathogenesis of this outstanding cause of death.

Interleukin-1 receptor antagonist gene (IL1RN) polymorphism possibly associated to severity of rheumatic carditis in a Brazilian cohort

Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.

Extracellular calcium stimulates Na+-dependent putrescine uptake in B16 melanoma cells

The regulation of putrescine transport in difluoromethylornithine-treated B16 melanoma cells by extracellular Ca2+ has been investigated. It was found that physiological concentrations of Ca2+ were essential for optimum uptake of putrescine and spermidine. Mg2+, albeit at higher concentrations, also could potentiate polyamine transport. The maximum rate of putrescine uptake increased from 1698 +/-: 67 pmol/min/mg DNA in the absence of Ca2+ to 3100 +/- 98 pmol/min/mg DNA in the presence of 0.5 mM Ca2+. There was no change in K-m. While Ca2+ enhanced transport of both putrescine and spermidine it did not affect the uptake of deoxyglucose, thymidine or leucine. Putrescine did not alter Ca2+ fluxes suggesting that the two cations do not share a common transport system. The effects of Ca2+ on putrescine uptake appeared to be mediated extracellularly firstly because Ca2+ did not potentiate putrescine uptake in the presence of A23187 and secondly, because the effects of Ca2+ were completely inhibited by the lanthanide Tb3+, which binds to calcium-dependent proteins and does not readily cross biological membranes. Ca2+ did not affect putrescine transport in the absence of extracellular Na+. Moreover, the rate of putrescine uptake in the absence of Ca2+ was similar to that in the absence of extracellular Na+. The results from this study indicate that polyamine transport is stimulated by extracellular Ca2+ and suggest that Ca2+ is required for activity of the Na+-dependent transporter only. This transporter appears to possess a regulatory binding site for divalent cations. (C) 1997 Elsevier Science Ltd.

TECNETIUM-99m AS ALTERNATIVE TO PRODUCE SOMATOSTATIN-LABELED DERIVATIVES: COMPARATIVE BIODISTRIBUTION EVALUATION WITH (111)In-DTPA-OCTREOTIDE

Synthetic somatostatin (SST) analogues have been used in the preparation of receptor-specific radiopharmaceuticals for diagnostic and therapy of neuroendocrine tumors. This work studied the labeling conditions with (99m)Tc and biological distribution in Swiss mice of two SST analogs (HYNIC-Tyr(3)-Octreotide and HYNIC-Tyr(3)-Octreotate) and compared the biodistribution pattern with (111)In-DTPA-Octreotide. Biological distribution studies were performed after injection of radiopharmaceuticals on Swiss mice. Labeling procedures resulted on high radiochemical yield for all three preparations and the labeled products presented high in vitro stability. Biological distribution studies evidenced similar general biodistribution of (99m)Tc-labeled peptides when compared with indium-labeled peptide with fast blood clearance and elimination by urinary tract. Kidneys uptake of (99m)Tc-HYNIC-TATE are similar to (111)In-DTPA-Octreotide, and both are significantly higher than (99m)Tc-HYNIC-OCT. All labeled peptides presented similar uptake on liver, but the retention in time at intestines, particularly at large intestine, was more expressive for (111)In-labeled peptide. The %ID of (99m)Tc-HYNIC-OCT and (99m)Tc-HYNIC-TATE in organs with high density of SST receptors like pancreas and adrenals were significant and similar to obtained for (111)In-DTPA-Octreotide, confirming the affinity of these radiopharmaceuticals for the receptors.

Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial Mediterranean fever

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

Concentration dependence of sodium permeation and sodium ion interactions in the cyclic AMP-gated channels of mammalian olfactory receptor neurons

The dependence of currents through the cyclic nucleotide-gated (CNG) channels of mammalian olfactory receptor neurons (ORNs) on the concentration of NaCl was studied in excised inside-out patches from their dendritic knobs using the patch-clamp technique. With a saturating concentration (100 mu M) of adenosine 3', 5'-cyclic monophosphate (cAMP), the changes in the reversal potential of macroscopic currents were studied at NaCl concentrations from 25 to 300 mM. In symmetrical NaCl solutions without the addition of divalent cations, the current-voltage relations were almost linear, reversing close to O mV. When the external NaCl concentration was maintained at 150 mM and the internal concentrations were varied, the reversal potentials of the cAMP-activated currents closely followed the Na+ equilibrium potential indicating that P-Cl/P-Na approximate to 0. However, at low external NaCl concentrations (less than or equal to 100 mM) there was some significant chloride permeability. Our results further indicated that Na+ currents through these channels: (i) did not obey the independence principle; (ii) showed saturation kinetics with K(m)s in the range of 100-150 mM and (iii) displayed a lack of voltage dependence of conductance in asymmetric solutions that suggested that ion-binding sites were situated midway along the channel. Together, these characteristics indicate that the permeation properties of the olfactory CNG channels are significantly different from those of photoreceptor CNG channels.

Non-expression of insulin-like growth factor-I receptor is associated with apoptosis: an ultrastructural study on rat ameloblasts

Insulin-like growth factor-I (IGF-I) is a preiotrophic polypeptide which appears to have roles both as a circulating endocrine hormone and as a locally synthesized paracrine or autocrine tissue factor. IGF-I plays a major role in regulating the growth of cells in vivo and in vitro and initiates metabolic and mitogenic processes in a wide variety of cell types by binding to specific type I receptors in the plasma membrane, In this study, we report the distribution of IGF-I receptors in odontogenic cells at the ultrastructural level using the high resolution protein A-gold technique, In the pre-secretory stage, very little gold label was visible over the ameloblasts and odontoblasts, During the secretory stage the label was mostly seen in association with the cell membranes and endoplasmic reticulum of the ameloblasts. Lysosome-like elements in the post-secretory stage were labelled as well as multivesicular dense bodies, Very little labelling was encountered in the ameloblasts in the transitional stage, where apoptotic bodies were clearly visible, The maturation stage also exhibited labelling of the secretory-like granules in the distal surface. The presence of gold particles over the plasma membrane is an indication that IGF-I receptor is a membrane-bound receptor. Furthermore, the intracellular distribution of the label over the endoplasmic reticulum supports the local synthesis of the IGF-I receptor. The absence of labelling over the transitional ameloblasts suggests that the transitional stage may require the non-expression of IGF-I as a prerequiste or even a trigger for apoptosis.