979 resultados para trichrome staining


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVES: To evaluate the color stability and hardness of two denture liners obtained by direct and indirect techniques, after thermal cycling and immersion in beverages that can cause staining of teeth. MATERIAL AND METHODS: Seventy disc-shaped specimens (18 x 3 mm) processed by direct (DT) and indirect techniques (IT) were made from Elite soft (n=35) and Kooliner (n=35) denture liners. For each material and technique, 10 specimens were subjected to thermal cycling (3,000 cycles) and 25 specimens were stored in water, coffee, tea, soda and red wine for 36 days. The values of color change, Shore A hardness (Elite soft) and Knoop hardness (Kooliner) were obtained. The data were subjected to ANOVA, Tukey's multiple-comparison test, and Kruskal-Wallis test (P<0.05). RESULTS: The thermal cycling promoted a decrease on hardness of Kooliner regardless of the technique used (Initial: 9.09± 1.61; Thermal cycling: 7.77± 1.47) and promoted an increase in the hardness in the DT for Elite Soft (Initial: 40.63± 1.07; Thermal cycling: 43.53± 1.03); hardness of Kooliner (DT: 8.76± 0.95; IT: 7.70± 1.62) and Elite Soft (DT: 42.75± 1.54; IT=39.30± 2.31) from the DT suffered an increase after the immersion in the beverages. The thermal cycling promoted color change only for Kooliner in the IT. Immersion in the beverages did not promote color change for Elite in both techniques. The control group of the DT of Kooliner showed a significant color change. Wine and coffee produced the greatest color change in the DT only for Elite Soft when compared to the other beverages. CONCLUSION: The three variation factors promoted alteration on hardness and color of the tested denture lining materials.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated the effect of surface sealant on the translucency of composite resin immersed in different solutions. The study involved the following materials: Charisma, Fortify and coffee, Coca-Cola®, tea and artificial saliva as solutions. Sixty-four specimens (n = 8) were manufactured and immersed in artificial saliva at 37 ± 1 °C. Samples were immersed in the solutions for three times a day and re-immersed in artificial saliva until the translucency readings. The measurements were carried out at nine times: T1 - 24 hours after specimen preparation, T2 - 24 hours after immersion in the solutions, T3 - 48 hours and T4 to T9 - 7, 14, 21, 30, 60 and 90 days, respectively, after immersion. The translucency values were measured using a JOUAN device. The results were subjected to ANOVA and Tukey's test at 5%. The surface sealant was not able to protect the composite resin against staining, the coffee showed the strongest staining action, followed by tea and regarding immersion time, a significant alteration was noted in the translucency of composite resin after 21 days.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: This study evaluated the influence of light sources and immersion media on the color stability of a nanofilled composite resin. MATERIAL AND METHODS: Conventional halogen, high-power-density halogen and high-power-density light-emitting diode (LED) units were used. There were 4 immersion media: coffee, tea, Coke® and artificial saliva. A total of 180 specimens (10 mm x 2 mm) were prepared, immersed in artificial saliva for 24 h at 37±1ºC, and had their initial color measured with a spectrophotometer according to the CIELab system. Then, the specimens were immersed in the 4 media during 60 days. Data from the color change and luminosity were collected and subjected to statistical analysis by the Kruskall-Wallis test (p<0.05). For immersion time, the data were subjected to two-way ANOVA test and Fisher's test (p<0.05). RESULTS: High-power-density LED (ΔE=1.91) promoted similar color stability of the composite resin to that of the tested halogen curing units (Jet Lite 4000 plus - ΔE=2.05; XL 3000 - ΔE=2.28). Coffee (ΔE=8.40; ΔL=-5.21) showed the highest influence on color stability of the studied composite resin. CONCLUSION: There was no significant difference in color stability regardless of the light sources, and coffee was the immersion medium that promoted the highest color changes on the tested composite resin.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Vimentin is a cytoeskeletal intermediate filament protein commonly observed in mesenchymal cells; however, it can also be found in malignant epithelial cells. It is demonstrated in several carcinomas, such as those of the cervix, breast and bladder, in which it is widely used as a marker of the epithelial to mesenchymal transition that takes place during embryogenesis and metastasis. Vimentin is associated with tumors that show a high degree of invasiveness, being detected in invasion front cells. Its expression seems to be influenced by the tumor microenvironment. The aim of this study was to evaluate vimentin expression in head and neck squamous cell carcinoma (HNSCC) cell lines, and to investigate the contribution of the microenvironment to its expression. HNSCC cell lines (HN6, HN30 and HN31) and an immortalized nontumorigenic cell line (HaCaT) were submitted to a three-dimensional assay with Matrigel. Cytoplasmatic staining of the HN6 cell line cultured without Matrigel and of the HN30 and HN31 cell lines cultured with Matrigel was demonstrated through immunohistochemistry. Western Blotting revealed a significant decrease in vimentin expression for the HN6 cell line and a significant increase for the HN30 and HN31 cell lines cultured with Matrigel. The results suggest that vimentin can be expressed in HNSCC cells and its presence is influenced by the microenvironment of a tumor.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: The purposes of this study were to histologically assess different types of oral squamous cell carcinoma and the silver-binding nucleolar organizer region (AgNOR) morphology in neoplastic cells, as well as to quantify the number of AgNORs in each type of carcinoma in order to relate AgNOR count and histologic grading. MATERIAL AND METHODS: Twenty-eight cases of oral squamous cell carcinoma were divided into 4 groups, namely well-differentiated, moderately differentiated, poorly differentiated, and undifferentiated. For NOR study, 3-µm-thick sections were stained with 50% aqueous silver nitrate solution. The predominant microscopic pattern of NORs was determined. Quantitative analyses of NORs were obtained of all cells present on each histological field using a 0.025 mm² eyepiece graticule. Different histological fields were analyzed until the total number of NORs was 120 cells for each tumor. Kruskall-Wallis test was applied to compare the groups of sample data at a significance level of p=0.05. RESULTS: The mean number of AgNORs per nucleus was 3.20 for the well-differentiated group, 5.33 for the moderately differentiated one, 8.27 for the poorly differentiated one, and 10.08 for the undifferentiated one. AgNOR count was significantly different (p<0.05) among all of the studied groups. CONCLUSION: AgNOR staining technique seems to be a useful diagnostic tool since differences in AgNOR numeric values can be identified in the different types of oral squamous cell carcinoma. This technique is easy to handle and inexpensive, thus justifying its large use in histopathology.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJETIVO: avaliar os efeitos da administração da associação zidovudina-lamivudina-ritonavir nos fígados e rins de ratas prenhes e seus conceptos do ponto de vista morfológico e fisiológico. MÉTODOS: 40 ratas albinas prenhes foram aleatoriamente divididas em 4 grupos: 1 controle (Ctrl: controle de veículo) e 3 experimentais (Exp1x, Exp3x e Exp9x). Estes últimos foram tratados por solução oral de zidovudina/lamivudina/ritonavir (Exp1x: 10/5/20 mg/kg; Exp3x: 30/15/60 mg/kg; Exp9x: 90/45/180 mg/kg). As drogas e o veículo foram administrados por gavagem, desde o 1º até o 20º dia de prenhez. No último dia do experimento, todos os animais foram anestesiados e sangue foi retirado da cavidade cardíaca para avaliação sérica das enzimas aspartato aminotransferase (AST) e alanina aminotransferase (ALT), por método calorimétrico, bem como da ureia, determinada por método cinético-enzimático, e creatinina, por método cinético-colorimétrico. Em seguida, fragmentos dos fígados e rins maternos e fetais foram coletados, fixados em formol a 10% e processados segundo os métodos histológicos para inclusão em parafina. Cortes com 5 µm de espessura foram corados pela hematoxilina-eosina (HE) e analisados por microscopia de luz. Na leitura das lâminas, considerou-se o padrão de normalidade para fígado e rins, tais como: hepatócitos, espaço porta íntegros e veias hepáticas bem definidas. Nos rins, a presença de corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Nos fígados fetais considerou-se, ainda, a morfologia das células da linhagem eritrocitária nas diferentes fases do desenvolvimento, bem como os megacariócitos. Quando houve alteração da coloração padrão estabelecida para as estruturas hepáticas e renais, alteração na morfologia de núcleos, rompimento de limites de alguma organela citoplasmática, presença de congestão vascular, tudo isso foi entendido como provavelmente provocado pelas drogas em sua(s) dose(s) de aplicação. A avaliação estatística foi realizada por análise de variância (ANOVA), completada pelo teste de Tukey-Kramer (p<0,05). RESULTADOS: os fígados maternos dos grupos Ctrl, Exp1x e Exp3x mostraram hepatócitos típicos, espaço porta íntegros e veias hepáticas com aspecto normal. No fígado materno do grupo Exp9x, foram encontrados hepatócitos com sinais de atrofia e apoptose (eosinofilia citoplasmática e núcleos picnóticos). Além disso, identificou-se vasodilatação dos capilares sinusoides (congestão). Os rins maternos dos grupos Ctrl e Exp1x apresentaram-se normais, com corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Já nos grupos Exp3x e Exp9x, foram encontrados congestão vascular, glomérulos pequenos ricos em células contendo núcleos hipercromáticos, sendo mais intensos no Exp9x. Com relação aos fígados e rins fetais, não foram observadas alterações morfológicas ou fisiológicas nos grupos estudados. Encontrou-se aumento significante nos níveis da AST (305,70±55,80; p<0,05) e da creatinina (0,50±0,09; p<0,05) no grupo Exp9x. CONCLUSÕES: nossos resultados evidenciam que a administração da associação zidovudina/lamivudina/ritonavir a ratas prenhes em altas doses causa alterações morfológicas e funcionais nos fígados e rins maternos. Não houve alterações nem morfológicas nem fisiológicas nos fígados e rins fetais.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The karyotype of Amphisbaena ridleyi, an endemic species of the archipelago of Fernando de Noronha, in State of Pernambuco, Brazil, is described after conventional staining, Ag-NOR impregnation and fluorescence in situ hybridization (FISH) with a telomeric probe. The diploid number is 46, with nine pairs of macrochromosomes (three metacentrics, four subtelocentrics and two acrocentrics) and 14 pairs of microchromosomes. The Ag-NOR is located in the telomeric region of the long arm of metacentric chromosome 2 and FISH revealed signals only in the telomeric region of all chromosomes. Further cytogenetic data on other amphisbaenians as well as a robust phylogenetic hypothesis of this clade is needed in order to understand the evolutionary changes on amphisbaenian karyotypes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Four populations of Astyanax hastatus Myers 1928 from the Guapimirim River basin (Rio de Janeiro State) were analyzed and three distinct cytotypes identified. These cytotypes presented 2n = 50 chromosomes, with 4M+8SM+10ST+28A (Cytotype A), 8M+10SM+14ST+18A (Cytotype B), 6M+8SM+4ST+32A (Cytotype C) and scanty heterochromatin, mainly located throughout pericentromeric regions of several chromosomal pairs. No homologies with the As-51 satellite DNA were observed in the three cytotypes, although all of them presented multiple 18S rDNA sites, as detected by both silver nitrate staining and FISH (fluorescent in situ hybridization). The application of the term "species complex" in Astyanax is discussed from a cytotaxonomic viewpoint.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pimelodidae is one of the most representative of Neotropical catfish families. However, these fish are still poorly studied in terms of cytogenetics, especially regarding the application of more accurate techniques such as the chromosomal localization of ribosomal genes. In the present work, fluorescent in situ hybridization with 5S and 18S rDNA probes was employed for rDNA site mapping in Pimelodus sp., P. fur and P. maculatus from the São Francisco River in the Três Marias municipality - MG. The results from the application of the 18S probe confirmed the previous data obtained by silver nitrate staining, identifying a simple nucleolar organizing region system for these species. However, the labeling results from the 5S rDNA probe demonstrated a difference in the number and localization of these sites between the analyzed species. The obtained data allowed inferences on the possible processes involved in the karyotypic evolution of this genus.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The genus Callistomys belongs to the rodent family Echimyidae, subfamily Echimyinae, and its only living representative is Callistomys pictus, a rare and vulnerable endemic species of the state of Bahia, Brazil. Callistomys has been previously classified as Nelomys, Loncheres, Isothrix and Echimys. In this paper we present the karyotype of Callistomys pictus, including CBG and GTG-banding patterns and silver staining of the nucleolus organizer regions (Ag-NORs). Comments on Callistomys pictus morphological traits and a compilation of Echimyinae chromosomal data are also included. Our analyses revealed that Callistomys can be recognized both by its distintinctive morphology and by its karyotype.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cefalópodes coleóides (lulas, sépias e polvos) produzem espermatóforos muito complexos que são transferidos à fêmea durante a cópula por meio do hectocótilo, um apêndice modificado nos machos. Durante a transferência à fêmea, ocorre a chamada "reação espermatofórica", complexo processo de evaginação do aparato ejaculatório do espermatóforo, que conduz à exteriorização da massa espermática e corpo cimentante. A presente revisão sintetiza o conhecimento acerca da morfologia e funcionamento desta estrutura exclusiva dos coleóides, identificando lacunas e definindo estratégias que possibilitem avanços na área. Poucos trabalhos abordam com detalhes a morfologia e anatomia funcional dos espermatóforos dos cefalópodes, grande parte do conhecimento acerca da estrutura do espermatóforo tendo sido gerada por trabalhos clássicos do século XIX e início do século XX. Investigações acerca do funcionamento dos espermatóforos são consideravelmente mais raras, estando o conhecimento básico sobre a reação espermatofórica restrito a apenas 19 espécies de coleóides. A revisão da literatura especializada permite sugerir que existem dois tipos básicos de fixação de espermatóforos em Decapodiformes (lulas e sepióides): fixação superficial e implante profundo (ou intra-dérmico). Na fixação superficial, comum em diversas espécies (e.g., Loliginidae, Sepiidae, Ommastrephidae), a base dos espermatângios é aderida ao tecido-alvo aparentemente por meio do corpo cimentante, a partir de substâncias adesivas e, em alguns casos, estruturas de fixação. No implante profundo, comum em alguns grupos de lulas oceânicas e de águas profundas (e.g., Architeuthidae, Cranchiidae, Octopoteuthidae, Sepiolidae), os espermatóforos implantam-se inteiramente no corpo da fêmea, de forma autônoma. Permanece desconhecido o mecanismo responsável pelo implante profundo. Em Octopodiformes (polvos), o espermatóforo é inserido no gonoduto feminino, alcançando a glândula oviducal, onde estão localizadas as espermatecas, ou a cavidade do ovário. Como o funcionamento extracorpóreo dos espermatóforos depende exclusivamente da intrincada estrutura e organização de seus componentes (e.g., membranas e túnicas), somente investigações detalhadas dessas estruturas proverão as bases para a compreensão do funcionamento e da exata função do complexo espermatóforo dos coleóides. Recomenda-se o desenvolvimento de um protocolo simples e eficiente para coloração e preparação total de espermatóforos, de forma que seja possível expandir as descrições morfológicas do espermatóforo em estudos taxonômicos e anatômicos, permitindo, portanto, ampliação do conhecimento acerca desta enigmática estrutura.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O desenvolvimento do sistema nervoso é bastante complexo, existindo poucos estudos sobre a organização dos envoltórios cerebrais relacionados ao crescimento encefálico. Utilizando como modelo experimental o rato, analisaram-se os diferentes aspectos estruturais e morfométricos da paquimeninge e leptomeninge durante o processo de envelhecimento. Foram utilizados quatro grupos de ratos em diferentes faixas etárias e analisadas as meninges em microscopias de luz e eletrônica. Verificamos que o grupo de ratos adultos apresentou uma maior área de fibras colágenas tanto do tipo I e quanto do tipo III, em relação aos outros grupos. Encontramos também que as fibras colágenas do tipo III em todos os grupos analisados ocupam uma maior área quando comparados com as fibras do tipo I. Os resultados revelam que a coloração de Weigert Oxona, que mostra fibras elásticas, elaunínicas e oxitalânicas, apresentou uma diferença estatisticamente maior de fibras quando comparados com as colorações de Weigert e Verhoeff, que mostra fíbras elaunínicas e elásticas, respectivamente. Os resultados ultra-estruturais demonstraram a presença de muitos fibroblastos e mitocôndrias tanto na paquimeninge como nas leptomeninges dos grupos de ratos neonatos e adultos, indicativo de alta atividade celular e conseqüentemente, intensa formação de tecido conjuntivo. Como as fibras colágenas do tipo III atuam na manutenção da estrutura de tecidos delicados e expansíveis, o estudo mostra que as funções das meninges encefálicas não estão relacionadas apenas com a resistência a trações e tensões a que estão sujeitas o encéfalo. Mas também a função relacionada com a distensibilidade dos vasos meníngeos e cerebrais de acordo com a necessidade do aporte sanguíneo em diversas funções específicas regionais do tecido nervoso.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVES: We investigated the influence of sildenafil on cardiac contractility and diastolic relaxation and examined the distribution of phosphodiesterase-5 in the hearts of hypertensive rats that were treated with by NG-nitro-L-arginine methyl ester (L-NAME). METHODS: Male Wistar rats were treated with L-NAME and/or sildenafil for eight weeks. The Langendorff method was used to examine the effects of sildenafil on cardiac contractility and diastolic relaxation. The presence and location of phosphodiesterase-5 and phosphodiesterase-3 were assessed by immunohistochemistry, and cGMP plasma levels were measured by ELISA. RESULTS: In isolated hearts, sildenafil prevented the reduction of diastolic relaxation (dP/dt) that was induced by L-NAME. In addition, phosphodiesterase-5 immunoreactivity was localized in the intercalated discs between the myocardial cells. The staining intensity was reduced by L-NAME, and sildenafil treatment abolished this reduction. Consistent with these results, the plasma levels of cGMP were decreased in the L-NAME-treated rats but not in rats that were treated with L-NAME + sildenafil. CONCLUSION: The sildenafil-induced attenuation of the deleterious hemodynamic and cardiac morphological effects of L-NAME in cardiac myocytes is mediated (at least in part) by the inhibition of phosphodiesterase-5.