985 resultados para statistical detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

In the field of educational and psychological measurement, the shift from paper-based to computerized tests has become a prominent trend in recent years. Computerized tests allow for more complex and personalized test administration procedures, like Computerized Adaptive Testing (CAT). CAT, following the Item Response Theory (IRT) models, dynamically generates tests based on test-taker responses, driven by complex statistical algorithms. Even if CAT structures are complex, they are flexible and convenient, but concerns about test security should be addressed. Frequent item administration can lead to item exposure and cheating, necessitating preventive and diagnostic measures. In this thesis a method called "CHeater identification using Interim Person fit Statistic" (CHIPS) is developed, designed to identify and limit cheaters in real-time during test administration. CHIPS utilizes response times (RTs) to calculate an Interim Person fit Statistic (IPS), allowing for on-the-fly intervention using a more secret item bank. Also, a slight modification is proposed to overcome situations with constant speed, called Modified-CHIPS (M-CHIPS). A simulation study assesses CHIPS, highlighting its effectiveness in identifying and controlling cheaters. However, it reveals limitations when cheaters possess all correct answers. The M-CHIPS overcame this limitation. Furthermore, the method has shown not to be influenced by the cheaters’ ability distribution or the level of correlation between ability and speed of test-takers. Finally, the method has demonstrated flexibility for the choice of significance level and the transition from fixed-length tests to variable-length ones. The thesis discusses potential applications, including the suitability of the method for multiple-choice tests, assumptions about RT distribution and level of item pre-knowledge. Also limitations are discussed to explore future developments such as different RT distributions, unusual honest respondent behaviors, and field testing in real-world scenarios. In summary, CHIPS and M-CHIPS offer real-time cheating detection in CAT, enhancing test security and ability estimation while not penalizing test respondents.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In questo elaborato vengono analizzate differenti tecniche per la detection di jammer attivi e costanti in una comunicazione satellitare in uplink. Osservando un numero limitato di campioni ricevuti si vuole identificare la presenza di un jammer. A tal fine sono stati implementati i seguenti classificatori binari: support vector machine (SVM), multilayer perceptron (MLP), spectrum guarding e autoencoder. Questi algoritmi di apprendimento automatico dipendono dalle features che ricevono in ingresso, per questo motivo è stata posta particolare attenzione alla loro scelta. A tal fine, sono state confrontate le accuratezze ottenute dai detector addestrati utilizzando differenti tipologie di informazione come: i segnali grezzi nel tempo, le statistical features, le trasformate wavelet e lo spettro ciclico. I pattern prodotti dall’estrazione di queste features dai segnali satellitari possono avere dimensioni elevate, quindi, prima della detection, vengono utilizzati i seguenti algoritmi per la riduzione della dimensionalità: principal component analysis (PCA) e linear discriminant analysis (LDA). Lo scopo di tale processo non è quello di eliminare le features meno rilevanti, ma combinarle in modo da preservare al massimo l’informazione, evitando problemi di overfitting e underfitting. Le simulazioni numeriche effettuate hanno evidenziato come lo spettro ciclico sia in grado di fornire le features migliori per la detection producendo però pattern di dimensioni elevate, per questo motivo è stato necessario l’utilizzo di algoritmi di riduzione della dimensionalità. In particolare, l'algoritmo PCA è stato in grado di estrarre delle informazioni migliori rispetto a LDA, le cui accuratezze risentivano troppo del tipo di jammer utilizzato nella fase di addestramento. Infine, l’algoritmo che ha fornito le prestazioni migliori è stato il Multilayer Perceptron che ha richiesto tempi di addestramento contenuti e dei valori di accuratezza elevati.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Substantial complexity has been introduced into treatment regimens for patients with human immunodeficiency virus (HIV) infection. Many drug-related problems (DRPs) are detected in these patients, such as low adherence, therapeutic inefficacy, and safety issues. We evaluated the impact of pharmacist interventions on CD4+ T-lymphocyte count, HIV viral load, and DRPs in patients with HIV infection. In this 18-month prospective controlled study, 90 outpatients were selected by convenience sampling from the Hospital Dia-University of Campinas Teaching Hospital (Brazil). Forty-five patients comprised the pharmacist intervention group and 45 the control group; all patients had HIV infection with or without acquired immunodeficiency syndrome. Pharmaceutical appointments were conducted based on the Pharmacotherapy Workup method, although DRPs and pharmacist intervention classifications were modified for applicability to institutional service limitations and research requirements. Pharmacist interventions were performed immediately after detection of DRPs. The main outcome measures were DRPs, CD4+ T-lymphocyte count, and HIV viral load. After pharmacist intervention, DRPs decreased from 5.2 (95% confidence interval [CI] =4.1-6.2) to 4.2 (95% CI =3.3-5.1) per patient (P=0.043). A total of 122 pharmacist interventions were proposed, with an average of 2.7 interventions per patient. All the pharmacist interventions were accepted by physicians, and among patients, the interventions were well accepted during the appointments, but compliance with the interventions was not measured. A statistically significant increase in CD4+ T-lymphocyte count in the intervention group was found (260.7 cells/mm(3) [95% CI =175.8-345.6] to 312.0 cells/mm(3) [95% CI =23.5-40.6], P=0.015), which was not observed in the control group. There was no statistical difference between the groups regarding HIV viral load. This study suggests that pharmacist interventions in patients with HIV infection can cause an increase in CD4+ T-lymphocyte counts and a decrease in DRPs, demonstrating the importance of an optimal pharmaceutical care plan.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In acquired immunodeficiency syndrome (AIDS) studies it is quite common to observe viral load measurements collected irregularly over time. Moreover, these measurements can be subjected to some upper and/or lower detection limits depending on the quantification assays. A complication arises when these continuous repeated measures have a heavy-tailed behavior. For such data structures, we propose a robust structure for a censored linear model based on the multivariate Student's t-distribution. To compensate for the autocorrelation existing among irregularly observed measures, a damped exponential correlation structure is employed. An efficient expectation maximization type algorithm is developed for computing the maximum likelihood estimates, obtaining as a by-product the standard errors of the fixed effects and the log-likelihood function. The proposed algorithm uses closed-form expressions at the E-step that rely on formulas for the mean and variance of a truncated multivariate Student's t-distribution. The methodology is illustrated through an application to an Human Immunodeficiency Virus-AIDS (HIV-AIDS) study and several simulation studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Attention deficit hyperactivity disorder (ADHD) is characterized by a persistent pattern of inattention and/or hyperactivity/impulsivity. The aim of this research was to contribute more precisely to the diagnosis of ADHD, to propose a battery of neuropsychological assessment and to analyze the contribution of each test. We studied 10 matched pairs of children with ADHD and normal controls (7 to 11 years). Inclusion criteria were: presence of ADHD typical behavior, positive diagnosis of ADHD based on DSM-IV, normal IQ, normal neurological examination and parental consent. We used extensive neuropsychological battery. The results showed differential sensitivity for detection of attentional problems in children with ADHD, although most tests did not reach statistical significance. The item, errors, of WCST revealed statistically significant difference between the two groups: ADHD performance was inferior to controls . In conclusion the neuropsychological assessment battery used in this research contributed to the diagnosis of ADHD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A flow injection method for the quantitative analysis of ketoconazole in tablets, based on the reaction with iron (III) ions, is presented. Ketoconazole forms a red complex with iron ions in an acid medium, with maximum absorbance at 495 nm. The detection limit was estimated to be 1×10--4 mol L-1; the quantitation limit is about 3×10--4 mol L-1 and approximately 30 determinations can be performed in an hour. The results were compared with those obtained with a reference HPLC method. Statistical comparisons were done using the Student's t procedure and the F test. Complete agreement was found at the 0.95 significance level between the proposed flow injection and the HPLC procedures. The two methods present similar precision, i.e., for HPLC the mean relative standard deviation was ca. 1.2% and for FIA ca. 1.6%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conventional radiography has shown limitation in acquiring image of the ATM region, thus, computed tomography (CT) scanning has been the best option to the present date for diagnosis, surgical planning and treatment of bone lesions, owing to its specific properties. OBJECTIVE: The aim of the study was to evaluate images of simulated bone lesions at the head of the mandible by multislice CT. MATERIAL AND METHODS: Spherical lesions were made with dental spherical drills (sizes 1, 3, and 6) and were evaluated by using multislice CT (64 rows), by two observers in two different occasions, deploying two protocols: axial, coronal, and sagittal images, and parasagittal images for pole visualization (anterior, lateral, posterior, medial and superior). Acquired images were then compared with those lesions in the dry mandible (gold standard) to evaluate the specificity and sensibility of both protocols. Statistical methods included: Kappa statistics, validity test and chi-square test. Results demonstrated the advantage of associating axial, coronal, and sagittal slices with parasagittal slices for lesion detection at the head of the mandible. RESULTS: There was no statistically significant difference between the types of protocols regarding a particular localization of lesions at the poles. CONCLUSIONS: Protocols for the assessment of the head of the mandible were established to improve the visualization of alterations of each of the poles of the mandible's head. The anterior and posterior poles were better visualized in lateral-medial planes while lateral, medial and superior poles were better visualized in the anterior-posterior plane.