The interaction of P160 BCR with BCR-ABL gene products unique to Philadelphia chromosome leukemias

The BCR gene is involved in the pathogenesis of Philadelphia chromosome-positive (Ph$\sp1$) leukemias. Typically, the 5$\sp\prime$ portion of BCR on chromosome 22 becomes fused to a 5$\sp\prime$ truncated ABL gene from chromosome 9 resulting in a chimeric BCR-ABL gene. To investigate the role of the BCR gene product, a number of BCR peptide sequences were used to generate anti-BCR antibodies for detection of BCR and BCR-ABL proteins. Since both BCR and ABL proteins have kinase activity, the anti-BCR antibodies were tested for their ability to immunoprecipitate BCR and BCR-ABL proteins from cellular lysates by use of an immunokinase assay. Antisera directed towards the C-terminal portions of P160 BCR, sequences not present in BCR-ABL proteins, were capable of co-immunoprecipitating P210 BCR-ABL from the Ph$\sp1$- positive cell line K562. Re-immunoprecipitation studies following complete denaturation showed that C-terminal BCR antisera specifically recognized P160 BCR but not P210 BCR-ABL. These and other results indicated the presence of a P160 BCR/P210 BCR-ABL protein complex in K562 cells. Experiments performed with Ph$\sp1$-positive ALL cells and uncultured Ph$\sp1$-positive patient white blood cells established the general presence of BCR/BCR-ABL protein complexes in BCR-ABL expressing cells. However, two cell lines derived from Ph$\sp1$-positive patients lacked P160 BCR/P210 BCR-ABL complexes. Lysates from one of these cell lines mixed with lysates from a cell line that expresses only P160 BCR failed to generate BCR/BCR-ABL protein complexes in vitro indicating that P160 BCR and P210 BCR-ABL do not simply oligomerize.^ Two-dimensional tryptic maps were performed on both BCR and BCR-ABL proteins labeled in vitro with $\sp{32}$P. These maps indicate that the autophosphorylation sites in BCR-ABL proteins are primarily located within BCR exon 1 sequences in both P210 and P185 BCR-ABL, and that P160 BCR is phosphorylated in trans in similar sites by the activated ABL kinase of both BCR-ABL proteins. These results provide strong evidence that P160 BCR serves as a target for the BCR-ABL oncoprotein.^ K562 cells, induced to terminally differentiate with the tumor promoter TPA, show a loss of P210 BCR-ABL kinase activity 12-18 hours after addition of TPA. This loss coincides with the loss of activity in P160 BCR/P210 BCR-ABL complexes but not with the loss of the P210 BCR-ABL, suggesting the existence of an inactive form of P210 BCR-ABL. However, a degraded BCR-ABL protein served as the kinase active form preferentially sequestered within the remaining BCR/BCR-ABL protein complex.^ The results described in this thesis form the basis for a model for BCR-ABL induced leukemias which is presented and discussed. ^

Nuclear proteins interacting with an AP-1/CRE-like promoter sequence in the human TNF$\alpha$ gene

Monocyte developmental heterogeneity is reflected at the cellular level by differential activation competence, at the molecular level by differential regulation of gene expression. LPS activates monocytes to produce tumor necrosis factor-$\alpha$ (TNF). Events occurring at the molecular level necessary for TNF regulation have not been elucidated, but depend both on activation signals and the maturation state of the cell: Peripheral blood monocytes produce TNF upon LPS stimulation, but only within the first 72 hours of culture. Expression of c-fos is associated with monocytic differentiation and activation; the fos-associated protein, c-jun, is also expressed during monocyte activation. Increased cAMP levels are associated with down regulation of macrophage function, including LPS-induced TNF transcription. Due to these associations, we studied a region of the TNF promoter which resembles the binding sites for both AP-1(fos/jun) and CRE-binding protein (or ATF) in order to identify potential molecular markers defining activation competent populations of monocytic cells.^ Nuclear protein binding studies using extracts from THP-1 monocytic cells stimulated with LPS, which stimulates, or dexamethasone (Dex) or pentoxyfilline (PTX), which inhibit TNF production, respectively, suggest that a low mobility doublet complex may be involved in regulation through this promoter region. PTX or Dex increase binding of these complexes equivalently over untreated cells; approximately two hours after LPS induction, the upper complex is undetectable. The upper complex is composed of ATF2 (CRE-BP1); the lower is a heterodimer of jun/ATF2. LPS induces c-jun and thus may enhance formation of jun-ATF2 complexes. The simultaneous presence of both complexes may reduce the amount of TNF transcription through competitive binding, while a loss of the upper (ATF2) and/or gain of the lower (jun-ATF2) allow increased transcription. AP-1 elements generally transduce signals involving PKC; the CRE mediates a cAMP response, involving PKA. Thus, this element has the potential of receiving signals through divergent signalling pathways. Our findings also suggest that cAMP-induced inhibition of macrophage functions may occur via down regulation of activation-associated genes through competitive binding of particular cAMP-responsive nuclear protein complexes. ^

Identification of two vitamin D response elements in the rat osteopontin gene

Studies to elucidate the function of vitamin D have demonstrated an important role in regulating bone-related cells, including osteoblasts and osteoclasts. A seemingly paradoxical observation is that 1,25(OH)$\sb2$D$\sb3$, the active metabolite of vitamin D, stimulates bone resorption, yet regulates transcription of genes expressed by osteoblasts. One mechanism that could explain these actions is the upregulation of transcription of osteoblast-specific genes. These gene products could then act as effectors to influence osteoclastic activity. We hypothesized that molecular signals could be deposited directly into the mineralized matrix in the form of noncollagenous proteins, such as osteopontin (OPN). The structure, biosynthesis and localization of OPN suggest that it could function to mediate the molecular "cross talk" between osteoblasts and osteoclasts in response to 1,25(OH)$\sb2$D$\sb3$. To begin to address this hypothesis, elucidation of the molecular mechanisms of action involved in the transactivation of OPN by 1,25(OH)$\sb2$D$\sb3$ is essential.^ In the present study, the rat opn gene was isolated and characterized. Functional analysis by transient transfection of the 5$\sp\prime$ flanking sequences of the rat opn gene fused to the luciferase gene demonstrated that OPN is transcriptionally upregulated by 1,25(OH)$\sb2$D$\sb3$, mediated through two vitamin D response elements (VDRE). Both proximal and distal VDREs are structurally similar (two imperfect direct repeats separated by a 3 nucleotide spacer) and bind protein complexes that include the VDR and retinoid-X receptor (RXR). Isolated VDRE expression constructs produce functional activity of equivalent magnitude of responsiveness to 1,25(OH)$\sb2$D$\sb3$. However, expression constructs containing either VDRE and at least 200 bp of 5$\sp\prime$ and 3$\sp\prime$ flanking sequence demonstrated that the distal VDRE produces an amplitude of response significantly higher than the proximal VDRE. We conclude that the transcriptional upregulation of the opn gene by 1,25(OH)$\sb2$D$\sb3$ involves the transactivation of two VDREs, while maximal responsiveness requires interaction of the VDREs with additional cis-elements contained in the 5$\sp\prime$ sequence. ^

Transcriptional regulation of the human {\it PAX6\/} gene

PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^

Mitochondrial outer membrane proteome of Trypanosoma brucei reveals macromolecular transport machineries and novel factors required to maintain mitochondrial morphology

The mitochondrial outer membrane (MOM) separates the mitochondria from the cytoplasm, serving both as a barrier and as a gateway. Protein complexes — believed to be universally conserved in all eukaryotes — reside in the MOM to orchestrate and control metabolite exchange, lipid metabolism and uptake of biopolymers such as protein and RNA. African trypanosomes are the causative agent of the sleeping sickness in humans. The parasites are among the earliest diverging eukaryotes that have bona fide mitochondria capable of oxidative phosphorylation. Trypanosomes have unique mitochondrial biology that concerns their mitochondrial metabolism and their unusual mitochondrial morphology that differs to great extent between life stages. Another striking feature is the organization of the mitochondrial genome that does not encode any tRNA genes, thus all tRNAs needed for mitochondrial translation have to be imported. However, the MOM of T. brucei is essentially unchartered territory. It lacks a canonical protein import machinery and facilitation of tRNA translocation remains completely elusive. Using biochemical fractionation and label-free quantitative mass spectrometry for correlated protein abundance-profiling we were able to identify a cluster of 82 candidate proteins that can be localized to the trypanosomal MOM with high confidence. This enabled us to identify a highly unusual, potentially archaic protein import machinery that might also transport tRNAs. Moreover, two-thirds of the identified polypeptides present on the MOM have never been associated with mitochondria before. 40 proteins share homology with proteins of known functions. The function of 42 proteins remains unknown. 11 proteins are essential for the disease-causing bloodstream form of T. brucei and therefore may be exploited as novel drug targets. A comparison with the outer membrane proteome of yeast defines a set of 17 common proteins that are likely present in the MOM of all eukaryotes. Known factors involved in the regulation of mitochondrial morphology are virtually absent in T. brucei. Interestingly, RNAi-mediated ablation of three outer membrane proteins of unknown function resulted in a collapse of the network-like mitochondrion of insect-stage parasites and therefore directly or indirectly are involved in the regulation of mitochondrial morphology.

Mitochondrial outer membrane proteome of T.brucei reveals novel factors required to maintain mitochondrial morphology.

The mitochondrial outer membrane (MOM) separates the mitochondria from the cytoplasm, serving both as a barrier and as a gateway. Protein complexes residing in the MOM orchestrate protein and tRNA import, metabolite exchange and lipid metabolism. African trypanosomes are among the earliest diverging eukaryotes that have bona fide mitochondria capable of oxidative phosphorylation. The MOM of T. brucei is essentially unchartered territory. It lacks a canonical TOM-complex and proteins are imported across the MOM using ATOM, which is related to both Tom40 and to the bacterial Omp85-protein family. The beta barrel membrane proteins ATOM, VDAC and Sam50 are the only MOM proteins that have been characterized in T. brucei so far. Using biochemical fractionation and correlated protein abundance-profiling we were able to identify a cluster of 82 candidate proteins that can be localized to the trypanosomal MOM with high confidence Two-thirds of these polypeptides have never been associated with mitochondria before. 40 proteins share homology with proteins of known functions. The function of 42 proteins remains unknown. 11 proteins are essential for the disease-causing bloodstream form of T. brucei and therefore may be exploited as novel drug targets. A comparison with the outer membrane proteome of yeast defines a set of 17 common proteins that are likely present in the MOM of all eukaryotes. Known factors involved in the regulation of mitochondrial morphology are virtually absent in T. brucei. Interestingly, RNAi-mediated ablation of three outer membrane proteins of unknown function resulted in a collapse of the network-like mitochondrion of procyclic cells and therefore directly or indirectly are involved in the regulation of mitochondrial morphology in T. brucei.

Dsh homolog DVL3 mediates resistance to IGFIR inhibition by regulating IGF-RAS signaling

Drugs that inhibit insulin-like growth factor 1 (IGFI) receptor IGFIR were encouraging in early trials, but predictive biomarkers were lacking and the drugs provided insufficient benefit in unselected patients. In this study, we used genetic screening and downstream validation to identify the WNT pathway element DVL3 as a mediator of resistance to IGFIR inhibition. Sensitivity to IGFIR inhibition was enhanced specifically in vitro and in vivo by genetic or pharmacologic blockade of DVL3. In breast and prostate cancer cells, sensitization tracked with enhanced MEK-ERK activation and relied upon MEK activity and DVL3 expression. Mechanistic investigations showed that DVL3 is present in an adaptor complex that links IGFIR to RAS, which includes Shc, growth factor receptor-bound-2 (Grb2), son-of-sevenless (SOS), and the tumor suppressor DAB2. Dual DVL and DAB2 blockade synergized in activating ERKs and sensitizing cells to IGFIR inhibition, suggesting a nonredundant role for DVL3 in the Shc-Grb2-SOS complex. Clinically, tumors that responded to IGFIR inhibition contained relatively lower levels of DVL3 protein than resistant tumors, and DVL3 levels in tumors correlated inversely with progression-free survival in patients treated with IGFIR antibodies. Because IGFIR does not contain activating mutations analogous to EGFR variants associated with response to EGFR inhibitors, we suggest that IGF signaling achieves an equivalent integration at the postreceptor level through adaptor protein complexes, influencing cellular dependence on the IGF axis and identifying a patient population with potential to benefit from IGFIR inhibition.

Detergent-induced stabilization and improved 3D map of the human heteromeric amino acid transporter 4F2hc-LAT2.

Human heteromeric amino acid transporters (HATs) are membrane protein complexes that facilitate the transport of specific amino acids across cell membranes. Loss of function or overexpression of these transporters is implicated in several human diseases such as renal aminoacidurias and cancer. HATs are composed of two subunits, a heavy and a light subunit, that are covalently connected by a disulphide bridge. Light subunits catalyse amino acid transport and consist of twelve transmembrane α-helix domains. Heavy subunits are type II membrane N-glycoproteins with a large extracellular domain and are involved in the trafficking of the complex to the plasma membrane. Structural information on HATs is scarce because of the difficulty in heterologous overexpression. Recently, we had a major breakthrough with the overexpression of a recombinant HAT, 4F2hc-LAT2, in the methylotrophic yeast Pichia pastoris. Microgram amounts of purified protein made possible the reconstruction of the first 3D map of a human HAT by negative-stain transmission electron microscopy. Here we report the important stabilization of purified human 4F2hc-LAT2 using a combination of two detergents, i.e., n-dodecyl-β-D-maltopyranoside and lauryl maltose neopentyl glycol, and cholesteryl hemisuccinate. The superior quality and stability of purified 4F2hc-LAT2 allowed the measurement of substrate binding by scintillation proximity assay. In addition, an improved 3D map of this HAT could be obtained. The detergent-induced stabilization of the purified human 4F2hc-LAT2 complex presented here paves the way towards its crystallization and structure determination at high-resolution, and thus the elucidation of the working mechanism of this important protein complex at the molecular level.

Revealing Assembly of a Pore-Forming Complex Using Single-Cell Kinetic Analysis and Modeling

Many biological processes depend on the sequential assembly of protein complexes. However, studying the kinetics of such processes by direct methods is often not feasible. As an important class of such protein complexes, pore-forming toxins start their journey as soluble monomeric proteins, and oligomerize into transmembrane complexes to eventually form pores in the target cell membrane. Here, we monitored pore formation kinetics for the well-characterized bacterial pore-forming toxin aerolysin in single cells in real time to determine the lag times leading to the formation of the first functional pores per cell. Probabilistic modeling of these lag times revealed that one slow and seven equally fast rate-limiting reactions best explain the overall pore formation kinetics. The model predicted that monomer activation is the rate-limiting step for the entire pore formation process. We hypothesized that this could be through release of a propeptide and indeed found that peptide removal abolished these steps. This study illustrates how stochasticity in the kinetics of a complex process can be exploited to identify rate-limiting mechanisms underlying multistep biomolecular assembly pathways.

DNA-DAMAGING REACTIONS OF NEOCARZINOSTATIN (ANTIBIOTICS, DNA REPAIR, CYTOTOXICITY)

Sensitive assays utilizing a cell-free and an intracellular system were employed to study the molecular bases of the DNA-damaging reactions of neocarzinostatin (NCS). In the cell-free DNA system, super-helical form I DNA from the bacteriophage PM2 was used as the substrate. The three forms of DNA present after treatment with NCS were separated by agarose gel electrophoresis. When NCS-damaged DNA was assayed under neutral conditions, there was a progressive decrease in the amount of surviving form I DNA and a corresponding increase in form II (nicked, relaxed circular) DNA, but very little increase in form III (linear duplex) DNA. This indicates that NCS introduces primarily single-strand breaks. However later studies showed that there were some site-specific double-strand breaks mediated by NCS on PM2 DNA. Seven such specific sites were mapped on the PM2 genome. When the damage was assayed under nondenaturing alkaline conditions or with the apurinic/apyrimidinic endonuclease IV, there was a slightly greater decrease in the amount of surviving form I DNA compared with neutral conditions indicating the presence of some alkali-labile sites.^ NCS-mediated DNA damage and repair were examined with cultured Chinese hamster ovary (CHO) cells using either alkaline elution for analysis of single-strand breaks or neutral elution for analysis of double-strand breaks. Most of the strand breaks introduced by NCS were capable of being rejoined. However, there was a small amount of residual DNA damage remaining unrejoined at 24-hr after removal of the drug. The amount of residual DNA damage was higher in a CHO mutant cell line (EM9) having a higher sensitivity to killing by NCS than its parental strain (AA8). Other lesions, DNA-protein complexes and alkali-labile sites, were detected after NCS treatment but they constituted only a small fraction of the DNA damage.^ Based on the above information, it can be postulated that NCS introduces some very lethal DNA damage. It is likely that the lethal lesions are a subset of the total DNA lesions representing the residual DNA damage. This DNA damage may be composed of site-specific, unrejoinable double-strand breaks and are thus the primary lesion leading to NCS-mediated lethality.^

Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

Regulation of the {\it neu\/} oncogene by the GTG element binding proteins

A previous study in our lab has shown that the transforming neu oncogene ($neu\sp\*$) was able to initiate signals that lead to repression of the neu promoter activity. Further deletion mapping of the neu promoter identified that the GTG element (GGTGGGGGGG), located between $-$243 and $-$234 relative to the translation initiation codon, mediates such a repression effect. I have characterized the four major protein complexes that interact with this GTG element. In situ UV-crosslinking indicated that each complex contains proteins of different molecular weights. The slowest migrating complex (S) contain Sp1 or Sp1-related proteins, as indicated by the data that both have similar molecular weights, similar properties in two affinity chromatographies, and both are antigenically related in gel shift analysis. Methylation protection and interference experiments demonstrated these complexes bind to overlapping regions of the GTG element. Mutations within the GTG element that either abrogate or enhance complex S binding conferred on the neu promoter with lower activity, indicating that positive factors other than Sp1 family proteins also contribute to neu promoter activity. A mutated version (mutant 4) of the GTG element, which binds mainly the fastest migrating complex that contains a very small protein of 26-kDa, can repress transcription when fused to a heterologous promoter. Further deletion and mutation studies suggested that this GTG mutant and its binding protein(s) may cooperate with some DNA element within a heterologous promoter to lock the basal transcription machinery; such a repressor might also repress neu transcription by interfering with the DNA binding of other transactivators. Our results suggest that both positive and negative trans-acting factors converge their binding sites on the GTG element and confer combinatorial control on the neu gene expression. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Analysis of VirB4, a membrane-associated ATPase subunit essential for T -complex transport in Agrobacterium tumefaciens

Agrobacterium tumefaciens is a plant pathogen with the unique ability to export oncogenic DNA-protein complexes (T-complexes) to susceptible plant cells and cause crown gall tumors. Delivery of the T-complexes across the bacterial membranes requires eleven VirB proteins and VirD4, which are postulated to form a transmembrane transporter. This thesis examines the subcellular localization and oligomeric structure of the 87-kDa VirB4 protein, which is one of three essential ATPases proposed to energize T-complex transport and/or assembly. Results of subcellular localization studies showed that VirB4 is tightly associated with the cytoplasmic membrane, suggesting that it is a membrane-spanning protein. The membrane topology of VirB4 was determined by using a nested deletion strategy to generate random fusions between virB4 and the periplasmically-active alkaline phosphatase, $\sp\prime phoA$. Analysis of PhoA and complementary $\beta$-galactosidase reporter fusions identified two putative periplasmically-exposed regions in VirB4. A periplasmic exposure of one of these regions was further confirmed by protease susceptibility assays using A. tumefaciens spheroplasts. To gain insight into the structure of the transporter, the topological configurations of other VirB proteins were also examined. Results from hydropathy analyses, subcellular localization, protease susceptibility, and PhoA reporter fusion studies support a model that all of the VirB proteins localize at one or both of the bacterial membranes. Immunoprecipitation and Co$\sp{2+}$ affinity chromatography studies demonstrated that native VirB4 (87-kDa) and a functional N-terminally tagged HIS-VirB4 derivative (89-kDa) interact and that the interaction is independent of other VirB proteins. A $\lambda$ cI repressor fusion assay supplied further evidence for VirB4 dimer formation. A VirB4 dimerization domain was localized to the N-terminal third of the protein, as judged by: (i) transdominance of an allele that codes for this region of VirB4; (ii) co-retention of a His-tagged N-terminal truncation derivative and native VirB4 on Co$\sp{2+}$ affinity columns; and (iii) dimer formation of the N-terminal third of VirB4 fused to the cI repressor protein. Taken together, these findings are consistent with a model that VirB4 is topologically configured as an integral cytoplasmic membrane protein with two periplasmic domains and that VirB4 assembles as homodimers via an N-terminal dimerization domain. Dimer formation is postulated to be essential for stabilization of VirB4 monomers during T-complex transporter assembly. ^

Regulation of tyrosine hydroxylase gene expression by mRNA stabilization

Tyrosine hydroxylase (TH) expression increases in adrenal chromaffin cells treated with the nicotinic agonist, dimethylphenylpiperazinium (DMPP; 1 μM). We are using this response as a model of the changes in TH level that occur during increased cholinergic neural activity. Here we report a 4-fold increase in TH mRNA half-life in DMPP-treated chromaffin cells that is apparent when using a pulse-chase analysis to measure TH mRNA half-life. No increase is apparent using actinomycin D to measure half-life, indicating a requirement for ongoing transcription. Characterization of protein binding to the TH 3′UTR using RNA electro-mobility shift assays show the presence of two complexes both of which are increased by DMPP-treatment. The faster migrating complex (FMC) increases 2.5-fold and the slower migrating complex (SMC) increases 1.5-fold. Separation of UV crosslinked RNA-protein complexes on SDS polyacrylamide gels shows FMC to contain a single protein whereas SMC contains two proteins. Northwesterns yielded similar results. Transfection studies reveal an increase in expression of the full-length TH transcript due to DMPP-treatment similar to that of endogenous TH mRNA. This finding suggests the increased expression is due primarily to mRNA stabilization. Transfection of luciferase reporter constructs containing regions of the TH 3′UTR reveal only the full-length 3′UTR influenced the expression level of reporter transcripts. ^