966 resultados para palladium (II) complexes
Resumo:
A new family of self-immobilized ethylene polymerization catalysts, derived from neutral, single-component salicylaldiminato phenyl nickel complexes, is described.
Resumo:
Three bridging ligands (L) and their binuclear phenanthroline ruthenium(II) complexes {[Ru(1,10-phenanthroline)(2)](2)(L)}(PF6)(4) were synthesized and characterized by IR, H-1 NMR, and elemental analysis, where L are 1,8-adipoylamido-bis(1,10-phenanthroline-5-yl) (L-1), 1,11-azelaoylamidobis(1, 10-phenanthroline-5-yl) (L-2), and p-phthaloylamido-bis(1,10-phenanthroline-5-yl) (L-3).
Resumo:
The efficient synthesis of 5-(5-bromovaleramido)-1,10-phenanthroline, 5-(6-bromohexanamido)-1,10-phenanthroline, and 5-(11-bromoundecanamido)-1,10-phenanthroline are described, which reacted with cis-Ru(bpy)(2)Cl-2. 2H(2)O and sodium hexafluorophosphate to form Ru(bpy)(2)[phen-NHCO(CH2)(n)Br](PF6)(2) (n = 4, 5 or 10; phen = 1,10-phenanthroline). The intricate H-1 NMR spectra at low field of these complexes were completely assigned in virtue of H-1-H-1 COSY technique. Cyclic voltammetry was used to study electrochemical behaviours of these complexes, and their luminescent properties were investigated with fluorescent spectra.
Resumo:
The theoretical model[17] of an ultramicroelectrode modified with a redox species film is used as the diagnostic tool to characterize the catalytic oxidation of ascorbic acid at carbon fiber ultramicrodisk electrodes coated with an Eastman-AQ-Os(bpy)(3)(2+) film. The electrocatalytic behavior of ascorbic acid at the ultramicroelectrode modified by an Eastman-AQ polymer containing tris(2,2'-bipyridine) osmium(III/II) as mediators is described. In order to determine the five characteristic currents quantitatively, the radius of the ultramicroelectrode and the concentration of ascorbic acid are varied systematically. The kinetic zone diagram has been used to study the electrocatalytic system. This system with 0.5-2.75 mM ascorbic acid belongs to SR + E case, and the concentration profiles of the catalyst in the film are given in detail. Finally, optimizing the design of catalytic system is discussed.
Resumo:
Epoxidation of styrene was catalyzed by some nickel(II) complexes, with NaOCl as the oxygen donor. The catalyst Ni(PA)(2). 2H(2)O has been found to be stable for the epoxidation of styrene. Some additives were introduced in the reaction to improve the "micro-environment" of the catalyst. Radical trap had little influence on styrene epoxidation. It was interesting to find that phase-transfer agent had negative influence on epoxidation in this biphase reaction. A possible mechanism of styrene epoxidation catalyzed by Ni(PA)(2). 2H(2)O has been proposed.
Resumo:
Treatment of Zn(Si(SiMe3)3)2 with ZnX2 (X = Cl, Br, I) in tetrahydrofuran (THF) at 23 °C afforded [Zn(Si(SiMe3)3)X(THF)]2 in 83–99% yield. X-ray crystal structures revealed dimeric structures with Zn2X2 cores. Thermogravimetric analyses of [Zn(Si(SiMe3)3)X(THF)]2 demonstrated a loss of coordinated THF between 50 and 155 °C and then single-step weight losses between 200 and 275 °C. The nonvolatile residue was zinc metal in all cases. Bulk thermolyses of [Zn(Si(SiMe3)3)X(THF)]2 between 210 and 250 °C afforded zinc metal in 97–99% yield, Si(SiMe3)3X in 91–94% yield, and THF in 81–98% yield. Density functional theory calculations confirmed that zinc formation becomes energetically favorable upon THF loss. Similar reactions are likely to be general for M(SiR3)n/MXn pairs and may lead to new metal-film-growth processes for chemical vapor deposition and atomic layer deposition.
Resumo:
Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.
Resumo:
Transient dynamical studies of bis[(5,5'-10,20-bis(2,6-bis(3,3-dimethylbutoxy)phenyl)porphinato)palladium(II)]ethyne (PPd(2)), 5,15-bis{[(5'-10,20-bis(2,6-bis(3,3-dimethylbutoxy)phenyl)porphinato)palladium(II)]ethynyl}(10,20-bis(2,6-bis(3,3-dimethylbutoxy)phenyl)porphinato)palladium(II) (PPd(3)), bis[(5,5'-10,20-bis(2,6-bis(3,3-dimethylbutoxy)phenyl)porphinato)platinum(II)]ethyne (PPt(2)), and 5,15-bis{[(5'-10,20-bis(2,6-bis(3,3-dimethylbutoxy)phenyl)porphinato)platinum(II)]ethynyl}(10,20-bis(2,6-bis(3,3-dimethylbutoxy)phenyl)porphinato)platinum(II) (PPt(3)) show that the electronically excited triplet states of these highly conjugated supermolecular chromophores can be produced at unit quantum yield via fast S(1) → T(1) intersystem crossing dynamics (τ(isc): 5.2-49.4 ps). These species manifest high oscillator strength T(1) → T(n) transitions over broad NIR spectral windows. The facts that (i) the electronically excited triplet lifetimes of these PPd(n) and PPt(n) chromophores are long, ranging from 5 to 50 μs, and (ii) the ground and electronically excited absorptive manifolds of these multipigment ensembles can be extensively modulated over broad spectral domains indicate that these structures define a new precedent for conjugated materials featuring low-lying π-π* electronically excited states for NIR optical limiting and related long-wavelength nonlinear optical (NLO) applications.
Resumo:
[Ru(BPY)2POQ-Nmet]2+ and [Ru(TAP)2POQ-Nmet]2+ (1 and 3) are bifunctional complexes composed of a metallic unit linked by a flexible chain to an organic unit. They have been prepared as photoprobes or photoreagents of DNA. In this work, the spectroscopic properties of these bifunctional complexes in the absence of DNA are compared with those of the monofunctional analogues [Ru(BPY)2Phen]2+, [Ru-(BPY)2acPhen]2+, [Ru(TAP)2Phen]2+, and [Ru(TAP)2acPhen]2+ (2 and 4). The electrospray mass spectrometry and absorption data show that the quinoline moiety exists in the protonated and nonprotonated form. Although the bifunctional complex containing 2,2′-bipyridine (BPY) ligands exhibits photophysical properties similar to those of the monofunctional compounds, the bifunctional complex with 1,4,5,8-tetraazaphenanthrene (TAP) ligands behaves quite differently. It has weaker relative emission quantum yields and shorter luminescence lifetimes than the monofunctional TAP analogue when the quinoline unit is nonprotonated. This indicates an efficient intramolecular quenching of the 3MLCT (metal to ligand charge transfer) excited state of the TAP metallic moiety. When the organic unit is protonated, there is no internal quenching. In organic solvent, the nonquenched excited metallic unit (bearing a protonated quinoline) and the quenched one (bearing a nonprotonated organic unit) are in slow equilibrium as compared to the lifetime of the two emitters. In aqueous solution this equilibrium is faster and is catalysed by the presence of phosphate buffer. Flash photolysis experiments suggest that the intramolecular quenching process originates from a photoinduced electron transfer from the nonprotonated quinoline to the excited Ru(TAP)2 2+ moiety.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Lewis acid complexes based on copper(II) and an imidazolium-tagged bis(oxazoline) have been used to catalyse the asymmetric Mukaiyama aldol reaction between methyl pyruvate and 1-methoxy-1-tri-methylsilyloxypropene under homogeneous and heterogeneous conditions. Although the ees obtained in ionic liquid were similar to those found in dichloromethane, there was a significant rate enhancement in the ionic liquid with reactions typically reaching completion within 2 min compared with only 55% conversion after 60 min in dichloromethane. However, this rate enhancement was offset by lower chemoselectivity in ionic liquids due to the formation of 3-hydroxy-1,3-diphenylbutan-1-one as a by-product. Supporting the catalyst on silica or an imidazolium-modified silica using the ionic liquid or in an ionic liquid-diethyl ether system completely suppressed the formation of this by-product without reducing the enantioselectivity. Although the heterogeneous systems were characterised by a drop in catalytic activity the system could be recycled up to five times without any loss in conversion or ee.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
Colourless single crystals of [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2) were obtained from aqueous and etheric solutions of the respective components Purine, (imidazo[4,5-d]pyrimidine, Pur), 3,5-dimethyl-4 '-amino-triazole (Dat) and bis(trifluoromethyl)mercury(II), Hg(CF3)(2). [Hg(CF3)(2)(Pur)](4) crystallizes with the tetragonal system (P-4, Z = 8, a = 1486.8(2), c = 1026.2(l) pm, R-all = 0.0657) with tetrameric molecules consisting of four purine molecules bridged by slightly bent Hg(CF3)2 molecules forming a cage with the CF3 ligands surrounding this cage. The two modifications of [Hg(Dat)(CF3)2]2 (1: 170 K, triclinic, P-1, Z = 2, a 814.9(2), b = 845.4(2), c = 968.4(3) pm, alpha = 106.55(2)degrees, beta= 103.41(2)degrees, gamma = 110.79(2)degrees, R-all = 0.1189; II: monoclinic, P2(1)/c, Z = 8, a = 879.8(2), b = 1731.0(3), c = 1593.9(3) pm, beta = 106.89(2)degrees, R-all = 0.1199) both contain dimeric molecules that are stacked parallel to one crystal axis to strands which are arranged in a parallel fashion in I and rotated against each other in 11 by 110 degrees. In both, the tetrameric [Hg(CF3)(2)(Pur)](4) and the dimeric [Hg(CF3)(2)(Dat)](2) the Hg(CF3)(2) molecules are slightly bent (around 167 and 170 degrees) and rather weakly attached to the N-donor ligands Pur and Dat with Hg-N distances around 272 pm, although in both cases the Hg atoms bridge between two ligand molecules.