992 resultados para auditory attention detection
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
The aim of this research was to analyze temporal auditory processing and phonological awareness in school-age children with benign childhood epilepsy with centrotemporal spikes (BECTS). Patient group (GI) consisted of 13 children diagnosed with BECTS. Control group (GII) consisted of 17 healthy children. After neurological and peripheral audiological assessment, children underwent a behavioral auditory evaluation and phonological awareness assessment. The procedures applied were: Gaps-in-Noise test (GIN), Duration Pattern test, and Phonological Awareness test (PCF). Results were compared between the groups and a correlation analysis was performed between temporal tasks and phonological awareness performance. GII performed significantly better than the children with BECTS (GI) in both GIN and Duration Pattern test (P < 0.001). GI performed significantly worse in all of the 4 categories of phonological awareness assessed: syllabic (P = 0.001), phonemic (P = 0.006), rhyme (P = 0.015) and alliteration (P = 0.010). Statistical analysis showed a significant positive correlation between the phonological awareness assessment and Duration Pattern test (P < 0.001). From the analysis of the results, it was concluded that children with BECTS may have difficulties in temporal resolution, temporal ordering, and phonological awareness skills. A correlation was observed between auditory temporal processing and phonological awareness in the suited sample.
Resumo:
Attention deficit hyperactivity disorder (ADHD) is characterized by a persistent pattern of inattention and/or hyperactivity/impulsivity. The aim of this research was to contribute more precisely to the diagnosis of ADHD, to propose a battery of neuropsychological assessment and to analyze the contribution of each test. We studied 10 matched pairs of children with ADHD and normal controls (7 to 11 years). Inclusion criteria were: presence of ADHD typical behavior, positive diagnosis of ADHD based on DSM-IV, normal IQ, normal neurological examination and parental consent. We used extensive neuropsychological battery. The results showed differential sensitivity for detection of attentional problems in children with ADHD, although most tests did not reach statistical significance. The item, errors, of WCST revealed statistically significant difference between the two groups: ADHD performance was inferior to controls . In conclusion the neuropsychological assessment battery used in this research contributed to the diagnosis of ADHD.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
O presente trabalho versa sobre o diagnóstico e a abordagem ortodôntica das anomalias dentárias, enfatizando os aspectos etiológicos que definem tais irregularidades de desenvolvimento. Parece existir uma inter-relação genética na determinação de algumas dessas anomalias, considerando-se a alta frequência de associações. Um mesmo defeito genético pode originar diferentes manifestações fenotípicas, incluindo agenesias, microdontias, ectopias e atraso no desenvolvimento dentário. As implicações clínicas das anomalias dentárias associadas são muito relevantes, uma vez que o diagnóstico precoce de uma determinada anomalia dentária pode alertar o clínico sobre a possibilidade de desenvolvimento de outras anomalias associadas no mesmo paciente ou em outros membros da família, permitindo a intervenção ortodôntica em época oportuna.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
Two experiments evaluated an operant procedure for establishing stimulus control using auditory and electrical stimuli as a baseline for measuring the electrical current threshold of electrodes implanted in the cochlea. Twenty-one prelingually deaf children, users of cochlear implants, learned a Go/No Go auditory discrimination task (i.e., pressing a button in the presence of the stimulus but not in its absence). When the simple discrimination baseline became stable, the electrical current was manipulated in descending and ascending series according to an adapted staircase method. Thresholds were determined for three electrodes, one in each location in the cochlea (basal, medial, and apical). Stimulus control was maintained within a certain range of decreasing electrical current but was eventually disrupted. Increasing the current recovered stimulus control, thus allowing the determination of a range of electrical currents that could be defined as the threshold. The present study demonstrated the feasibility of the operant procedure combined with a psychophysical method for threshold assessment, thus contributing to the routine fitting and maintenance of cochlear implants within the limitations of a hospital setting.
Resumo:
RATIONALE: Benign focal seizures of adolescence (BFSA) described by Loiseau et al in 1972, is considered a rare entity, but maybe underdiagnosed. Although mild neuropsychological deficits have been reported in patients with benign epilepsies of childhood, these evaluations have not so far been described in BFSA. The aim of this study is to evaluate neuropsychological functions in BFSA with new onset seizures (<12 months). METHODS: Eight patients with BFSA (according to Loiseau et al, 1972, focal or secondarily tonic clonic generalized seizures between the ages of 10-18 yrs., normal neurologic examination, normal EEG or with mild focal abnormalities) initiated in the last 12 months were studied between July 2008 to May 2009. They were referred from the Pediatric Emergency Section of the Hospital Universitário of the University of Sao Paulo, a secondary care regionalized facility located in a district of middle-low income in Sao Paulo city, Brazil. The study was approved by the Ethics Committee of the Institution. All patients performed neurological, EEG, brain CT and neuropsychological evaluation which consisted of Raven's Special Progressive Matrices - General and Special Scale (according to different ages), Wechsler Children Intelligence Scale-WISC III with ACID Profile, Trail Making Test A/B, Stroop Test, Bender Visuo-Motor Test, Rey Complex Figure, Rey Auditory Verbal Learning Test-RAVLT, Boston Naming Test, Fluency Verbal for phonological and also conceptual patterns - FAS/Animals and Hooper Visual Organization Test. For academic achievement, we used a Brazilian test for named "Teste do Desempenho Escolar", which evaluates abilities to read, write and calculate according to school grade. RESULTS: There were 2 boys and 6 girls, with ages ranging from 10 yrs. 9 m to 14 yrs. 3 m. Most (7/8) of the patients presented one to two seizures and only three of them received antiepileptic drugs (AEDs). Six had mild EEG focal abnormalities and all had normal brain CT. All were literate, attended regular public schools and scored in a median range for IQ, and seven showed discrete higher scores for the verbal subtests. There were low scores for attention in different modalities in six patients, mainly in alternated attention as well as inhibitory subtests (Stroop test and Trail Making Test part B). Four of the latter cases who showed impairment both in alternated and inhibitory attention were not taking AEDs. Visual memory was impaired in five patients (Rey Complex Figure). Executive functions analysis showed deficits in working memory in five, mostly observed in Digits Indirect Order and Arithmetic tests (WISC III). Reading and writing skills were below the expected average for school grade in six patients according to the achievement scholar performance test utilized. One patient of this series who had the best scores in all tests was taking phenobarbital. CONCLUSIONS: Neuropsychological imbalance between normal IQ and mild dysfunctions such as in attention domain and in some executive abilities like working memory and planning, as well as difficulties in visual memory and in reading and writing, were described in this group of patients with BFSA from community. This may reflect mild higher level neurological dysfunctions in adolescence idiopathic focal seizures probably caused by an underlying dysmaturative epileptogenic process. Although academic problems often have multiple causes, a specific educational approach may be necessary in these adolescents, in order to improve their scholastic achievements, helping in this way, to decrease the stigma associated to epileptic seizures in the community.
Resumo:
We recently demonstrated that automatic attention favors the right side of space and, in the present study, we investigated whether voluntary attention also favors this side. Six reaction time experiments were conducted. In each experiment, 12 new 18-25-year-old male right-handed individuals were tested. In Experiments 1, 2, 3 (a, b) and 4 (a, b), tasks with increasing attentional demands were used. In Experiments 1, 2, 3a, and 4a, attention was oriented to one or both sides by means of a central spatially informative visual cue. A left or right side visual target appeared 100, 300, or 500 ms later. Attentional effects were observed in the four experiments. In Experiments 2, 3a and 4a, these effects were greater when the cue indicated the right side than when it indicated the left side (respectively: 16 ± 10 and 44 ± 6 ms, P = 0.015, for stimulus onset asynchrony of 500 ms in Experiment 2; 38 ± 10 and 70 ± 7 ms, P = 0.011, for Experiment 3a, and 23 ± 11 and 61 ± 10 ms, P = 0.009, for Experiment 4a). In Experiments 3b and 4b, the central cue pointed to both sides and was said to be non-relevant for task performance. In these experiments right and left reaction times did not differ. The most conservative interpretation of the present findings is that voluntary attention orienting favors the right side of space, particularly when a difficult task has to be performed.
Resumo:
A long-standing debate in the literature is whether attention can form two or more independent spatial foci in addition to the well-known unique spatial focus. There is evidence that voluntary visual attention divides in space. The possibility that this also occurs for automatic visual attention was investigated here. Thirty-six female volunteers were tested. In each trial, a prime stimulus was presented in the left or right visual hemifield. This stimulus was characterized by the blinking of a superior, middle or inferior ring, the blinking of all these rings, or the blinking of the superior and inferior rings. A target stimulus to which the volunteer should respond with the same side hand or a target stimulus to which she should not respond was presented 100 ms later in a primed location, a location between two primed locations or a location in the contralateral hemifield. Reaction time to the positive target stimulus in a primed location was consistently shorter than reaction time in the horizontally corresponding contralateral location. This attentional effect was significantly smaller or absent when the positive target stimulus appeared in the middle location after the double prime stimulus. These results suggest that automatic visual attention can focus on two separate locations simultaneously, to some extent sparing the region in between.