The prevalence and regulation of antisense transcripts in Schizosaccharomyces pombe.

A strand-specific transcriptome sequencing strategy, directional ligation sequencing or DeLi-seq, was employed to profile antisense transcriptome of Schizosaccharomyces pombe. Under both normal and heat shock conditions, we found that polyadenylated antisense transcripts are broadly expressed while distinct expression patterns were observed for protein-coding and non-coding loci. Dominant antisense expression is enriched in protein-coding genes involved in meiosis or stress response pathways. Detailed analyses further suggest that antisense transcripts are independently regulated with respect to their sense transcripts, and diverse mechanisms might be potentially involved in the biogenesis and degradation of antisense RNAs. Taken together, antisense transcription may have profound impacts on global gene regulation in S. pombe.

Development of universal antidotes to control aptamer activity.

With an ever increasing number of people taking numerous medications, the need to safely administer drugs and limit unintended side effects has never been greater. Antidote control remains the most direct means to counteract acute side effects of drugs, but, unfortunately, it has been challenging and cost prohibitive to generate antidotes for most therapeutic agents. Here we describe the development of a set of antidote molecules that are capable of counteracting the effects of an entire class of therapeutic agents based upon aptamers. These universal antidotes exploit the fact that, when systemically administered, aptamers are the only free extracellular oligonucleotides found in circulation. We show that protein- and polymer-based molecules that capture oligonucleotides can reverse the activity of several aptamers in vitro and counteract aptamer activity in vivo. The availability of universal antidotes to control the activity of any aptamer suggests that aptamers may be a particularly safe class of therapeutics.

Development of the morpholino gene knockdown technique in Fundulus heteroclitus: a tool for studying molecular mechanisms in an established environmental model.

A significant challenge in environmental toxicology is that many genetic and genomic tools available in laboratory models are not developed for commonly used environmental models. The Atlantic killifish (Fundulus heteroclitus) is one of the most studied teleost environmental models, yet few genetic or genomic tools have been developed for use in this species. The advancement of genetic and evolutionary toxicology will require that many of the tools developed in laboratory models be transferred into species more applicable to environmental toxicology. Antisense morpholino oligonucleotide (MO) gene knockdown technology has been widely utilized to study development in zebrafish and has been proven to be a powerful tool in toxicological investigations through direct manipulation of molecular pathways. To expand the utility of killifish as an environmental model, MO gene knockdown technology was adapted for use in Fundulus. Morpholino microinjection methods were altered to overcome the significant differences between these two species. Morpholino efficacy and functional duration were evaluated with molecular and phenotypic methods. A cytochrome P450-1A (CYP1A) MO was used to confirm effectiveness of the methodology. For CYP1A MO-injected embryos, a 70% reduction in CYP1A activity, a 86% reduction in total CYP1A protein, a significant increase in beta-naphthoflavone-induced teratogenicity, and estimates of functional duration (50% reduction in activity 10 dpf, and 86% reduction in total protein 12 dpf) conclusively demonstrated that MO technologies can be used effectively in killifish and will likely be just as informative as they have been in zebrafish.

The receptor kinase family: primary structure of rhodopsin kinase reveals similarities to the beta-adrenergic receptor kinase.

Light-dependent deactivation of rhodopsin as well as homologous desensitization of beta-adrenergic receptors involves receptor phosphorylation that is mediated by the highly specific protein kinases rhodopsin kinase (RK) and beta-adrenergic receptor kinase (beta ARK), respectively. We report here the cloning of a complementary DNA for RK. The deduced amino acid sequence shows a high degree of homology to beta ARK. In a phylogenetic tree constructed by comparing the catalytic domains of several protein kinases, RK and beta ARK are located on a branch close to, but separate from the cyclic nucleotide-dependent protein kinase and protein kinase C subfamilies. From the common structural features we conclude that both RK and beta ARK are members of a newly delineated gene family of guanine nucleotide-binding protein (G protein)-coupled receptor kinases that may function in diverse pathways to regulate the function of such receptors.

Molecular cloning and expression of the cDNA for the hamster alpha 1-adrenergic receptor.

The cDNA for the Syrian hamster alpha 1-adrenergic receptor has been cloned with oligonucleotides corresponding to the partial amino acid sequence of the receptor protein purified from DDT1MF-2 smooth muscle cells. The deduced amino acid sequence encodes a 515-residue polypeptide that shows the most sequence identity with the other adrenergic receptors and the putative protein product of the related clone G-21. Similarities with the muscarinic cholinergic receptors are also evident. Expression studies in COS-7 cells confirm that we have cloned the alpha 1-adrenergic receptor that couples to inositol phospholipid metabolism.

Antisense Gene Silencing and Bacteriophages as Novel Disinfection Processes for Engineered Systems

The growth and proliferation of invasive bacteria in engineered systems is an ongoing problem. While there are a variety of physical and chemical processes to remove and inactivate bacterial pathogens, there are many situations in which these tools are no longer effective or appropriate for the treatment of a microbial target. For example, certain strains of bacteria are becoming resistant to commonly used disinfectants, such as chlorine and UV. Additionally, the overuse of antibiotics has contributed to the spread of antibiotic resistance, and there is concern that wastewater treatment processes are contributing to the spread of antibiotic resistant bacteria.

Due to the continually evolving nature of bacteria, it is difficult to develop methods for universal bacterial control in a wide range of engineered systems, as many of our treatment processes are static in nature. Still, invasive bacteria are present in many natural and engineered systems, where the application of broad acting disinfectants is impractical, because their use may inhibit the original desired bioprocesses. Therefore, to better control the growth of treatment resistant bacteria and to address limitations with the current disinfection processes, novel tools that are both specific and adaptable need to be developed and characterized.

In this dissertation, two possible biological disinfection processes were investigated for use in controlling invasive bacteria in engineered systems. First, antisense gene silencing, which is the specific use of oligonucleotides to silence gene expression, was investigated. This work was followed by the investigation of bacteriophages (phages), which are viruses that are specific to bacteria, in engineered systems.


For the antisense gene silencing work, a computational approach was used to quantify the number of off-targets and to determine the effects of off-targets in prokaryotic organisms. For the organisms of Escherichia coli K-12 MG1655 and Mycobacterium tuberculosis H37Rv the mean number of off-targets was found to be 15.0 + 13.2 and 38.2 + 61.4, respectively, which results in a reduction of greater than 90% of the effective oligonucleotide concentration. It was also demonstrated that there was a high variability in the number of off-targets over the length of a gene, but that on average, there was no general gene location that could be targeted to reduce off-targets. Therefore, this analysis needs to be performed for each gene in question. It was also demonstrated that the thermodynamic binding energy between the oligonucleotide and the mRNA accounted for 83% of the variation in the silencing efficiency, compared to the number of off-targets, which explained 43% of the variance of the silencing efficiency. This suggests that optimizing thermodynamic parameters must be prioritized over minimizing the number of off-targets. In conclusion for the antisense work, these results suggest that off-target hybrids can account for a greater than 90% reduction in the concentration of the silencing oligonucleotides, and that the effective concentration can be increased through the rational design of silencing targets by minimizing off-target hybrids.

Regarding the work with phages, the disinfection rates of bacteria in the presence of phages was determined. The disinfection rates of E. coli K12 MG1655 in the presence of coliphage Ec2 ranged up to 2 h-1, and were dependent on both the initial phage and bacterial concentrations. Increasing initial phage concentrations resulted in increasing disinfection rates, and generally, increasing initial bacterial concentrations resulted in increasing disinfection rates. However, disinfection rates were found to plateau at higher bacterial and phage concentrations. A multiple linear regression model was used to predict the disinfection rates as a function of the initial phage and bacterial concentrations, and this model was able to explain 93% of the variance in the disinfection rates. The disinfection rates were also modeled with a particle aggregation model. The results from these model simulations suggested that at lower phage and bacterial concentrations there are not enough collisions to support active disinfection rates, which therefore, limits the conditions and systems where phage based bacterial disinfection is possible. Additionally, the particle aggregation model over predicted the disinfection rates at higher phage and bacterial concentrations of 108 PFU/mL and 108 CFU/mL, suggesting other interactions were occurring at these higher concentrations. Overall, this work highlights the need for the development of alternative models to more accurately describe the dynamics of this system at a variety of phage and bacterial concentrations. Finally, the minimum required hydraulic residence time was calculated for a continuous stirred-tank reactor and a plug flow reactor (PFR) as a function of both the initial phage and bacterial concentrations, which suggested that phage treatment in a PFR is theoretically possible.

In addition to determining disinfection rates, the long-term bacterial growth inhibition potential was determined for a variety of phages with both Gram-negative and Gram-positive bacteria. It was determined, that on average, phages can be used to inhibit bacterial growth for up to 24 h, and that this effect was concentration dependent for various phages at specific time points. Additionally, it was found that a phage cocktail was no more effective at inhibiting bacterial growth over the long-term than the best performing phage in isolation.

Finally, for an industrial application, the use of phages to inhibit invasive Lactobacilli in ethanol fermentations was investigated. It was demonstrated that phage 8014-B2 can achieve a greater than 3-log inactivation of Lactobacillus plantarum during a 48 h fermentation. Additionally, it was shown that phages can be used to protect final product yields and maintain yeast viability. Through modeling the fermentation system with differential equations it was determined that there was a 10 h window in the beginning of the fermentation run, where the addition of phages can be used to protect final product yields, and after 20 h no additional benefit of the phage addition was observed.

In conclusion, this dissertation improved the current methods for designing antisense gene silencing targets for prokaryotic organisms, and characterized phages from an engineering perspective. First, the current design strategy for antisense targets in prokaryotic organisms was improved through the development of an algorithm that minimized the number of off-targets. For the phage work, a framework was developed to predict the disinfection rates in terms of the initial phage and bacterial concentrations. In addition, the long-term bacterial growth inhibition potential of multiple phages was determined for several bacteria. In regard to the phage application, phages were shown to protect both final product yields and yeast concentrations during fermentation. Taken together, this work suggests that the rational design of phage treatment is possible and further work is needed to expand on this foundation.

Comparison of the thermodynamics and base-pair dynamics of a full LNA:DNA duplex and of the isosequential DNA:DNA duplex

Locked nucleic acids (LNA), conformationally restricted nucleotide analogues, are known to enhance pairing stability and selectivity toward complementary strands. With the aim to contribute to a better understanding of the origin of these effects, the structure, thermal stability, hybridization thermodynamics, and base-pair dynamics of a full-LNA:DNA heteroduplex and of its isosequential DNA:DNA homoduplex were monitored and compared. CD measurements highlight differences in the duplex structures: the homoduplex and heteroduplex present B-type and A-type helical conformations, respectively. The pairing of the hybrid duplex is characterized, at all temperatures monitored (between 15 and 37 degrees C), by a larger stability constant but a less favorable enthalpic term. A major contribution to this thermodynamic profile emanates from the presence of a hairpin structure in the LNA single strand which contributes favorably to the entropy of interaction but leads to an enthalpy penalty upon duplex formation. The base-pair opening dynamics of both systems was monitored by NMR spectroscopy via imino protons exchange measurements. The measurements highlight that hybrid G-C base-pairs present a longer base-pair lifetime and higher stability than natural G-C base-pairs, but that an LNA substitution in an A-T base-pair does not have a favorable effect on the stability. The thermodynamic and dynamic data confirm a more favorable stacking of the bases in the hybrid duplex. This study emphasizes the complementarities between dynamic and thermodynamical studies for the elucidation of the relevant factors in binding events.

Safety and efficacy of drisapersen for the treatment of Duchenne muscular dystrophy (DEMAND II): an exploratory, randomised, placebo-controlled phase 2 study.

Duchenne muscular dystrophy is caused by dystrophin deficiency and muscle deterioration and preferentially affects boys. Antisense-oligonucleotide-induced exon skipping allows synthesis of partially functional dystrophin. We investigated the efficacy and safety of drisapersen, a 2'-O-methyl-phosphorothioate antisense oligonucleotide, given for 48 weeks.

Solid-phase synthesis of terminal oligonucleotide-phosphoramidate conjugates

A novel phosphoramidite, N,N-diisopropylamino-2-cyanoethyl-9-anthracenemethyl phosphoramidite 1, was prepared and coupled with the terminal 5'-hydroxyl of support-bound T10 and the putative phosphite triester intermediate was subsequently reacted with iodine in the presence of either water or a series of primary and secondary amines. The reactivity of 1 compared to a previously reported benzyl phosphoramidite 2 was also investigated: oxidation of the product of coupling 2 with CPG-T10-5'OH under aqueous conditions resulted in greater than 30% of the benzyl moiety being retained. In contrast, essentially complete loss of the 9-anthracenemethyl group was observed using 1 under the same conditions. Oligonucleotides modified with a terminal phosphate monoester, lipophilic, fluorescent or cationic groups were thus prepared.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Antisense Bcl-2 Oligonucleotide Uptake in Human Transitional Cell Carcinoma.

Objectives; Antisense oligonucleotides (AO) downregulate Bcl-2 protein expression in various tumours if good target cell uptake is achieved. In this study, uptake of FITC labelled AO (FITC-AO) directed at Bcl-2 was examined in; (1) the RT4 bladder tumour cell line (2) normal pig urothelium and (3) human superficial bladder tumours. Methods; In the RT4 cell line, uptake of FITC-AO, FITC-scrambled and FITC-sense oligonucleotides were quantified by flow cytometry at 4h intervals over 24h. Uptake of FITC-AO was assessed in normal pig urothelium by flow cytometry after FITC-AO was infused for 1h. Uptake of FITC AO was assessed in samples from 14 human superficial bladder tumours which were maintained in an ex vivo model. In samples from 6 tumours, uptake at 4h was assessed using fluorescence microscopy. In samples from 8 separate tumours uptake every 4h within the first 24h incubation period was assessed by flow cytometry. Results; In the RT4 cell line the FITC-AO, FITC-scrambled and FITC-sense oligonucleotide uptake was similar. Disaggregated cells from the normal urothelium of the three pigs exhibited 33%, 46%, 51% of cells staining positively for FITC-AO as determined by flow cytometry. All 6 tumour samples had detectable intracellular FITC-AO by fluorescence microscopy at 4h. In the 8 tumours ,examined over the 24h incubation period, there was a range of percentages of positively staining cells. However, most tumours had a monotonic increase in intracellular fluorescence intensity that plateaued 16h post infusion. Conclusion; Antisense Bcl-2 oligonucleotides were readily taken up by superficial bladder cancer cells but the heterogenous uptake in tumour samples needs to be considered when assessing the bioavailability of these drugs.

A novel structural class of photoswitchable oligonucleotide

Directed Michaelis–Arbuzov reactions of support-bound internucleotide O-benzyl- or O-methyl-phosphite triesters with meta-phenylazobenzylamine or alkane-/glycol-linked a,x-diamines were effected in the presence of iodine. The corresponding tritylated phosphoramidate-linked 11-mers were fully deprotected and released from the support under standard conditions and the fast- and slow-diastereoisomers of both the E- and the Z-meta-phenylazobenzyl-appended oligomers were readily resolved by RP-HPLC. The primary amine-functionalised oligonucleotides were either purified, detritylated and then finally treated with Nhydroxysuccinimidyl carboxylic acid ester derivatives of photoswitchable moieties (Route A) or first derivatised and then subsequently purified and detritylated (Route B). This latter route enabled resolution of fast- and slow-isomers of the trityl-on oligomers bearing novel photoswitchable azopyridine or 9-alkoxyanthracene moieties using RP-HPLC, following which the pure diastereoisomers were detritylated and characterised by MALDI-MS.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

Targeting death receptors in bladder, prostate and renal cancer

PURPOSE: We describe key components of normal and aberrant death receptor pathways, the association of these abnormalities with tumorigenesis in bladder, prostate and renal cancer, and their potential application in novel therapeutic strategies targeted toward patients with cancer.

MATERIALS AND METHODS: A MEDLINE literature search of the key words death receptors, TRAIL (tumor necrosis factor related apoptosis inducing ligand), FAS, bladder, prostate, renal and cancer was done to obtain information for review. A brief overview of the TRAIL and FAS death receptor pathways, and their relationship to apoptosis is described. Mechanisms that lead to nonfunction of these pathways and how they may contribute to tumorigenesis are linked. Current efforts to target death receptor pathways as a therapeutic strategy are highlighted.

RESULTS: Activation of tumor cell expressing death receptors by cytotoxic immune cells is the main mechanism by which the immune system eliminates malignant cells. Death receptor triggering induces a caspase cascade, leading to tumor cell apoptosis. Receptor gene mutation or hypermethylation, decoy receptor or splice variant over expression, and downstream inhibitor interference are examples of the ways that normal pathway functioning is lost in cancers of the bladder and prostate. Targeting death receptors directly through synthetic ligand administration and blocking downstream inhibitor molecules with siRNA or antisense oligonucleotides represent novel therapeutic strategies under development.

CONCLUSIONS: Research into the death receptor pathways has demonstrated the key role that pathway aberrations have in the initiation and progression of malignancies of the bladder, prostate and kidney. This new understanding has resulted in exciting approaches to restore the functionality of these pathways as a novel therapeutic strategy.