Query Library Development and Anomaly Detection on Flight Data

During the last semester of the Master’s Degree in Artificial Intelligence, I carried out my internship working for TXT e-Solution on the ADMITTED project. This paper describes the work done in those months. The thesis will be divided into two parts representing the two different tasks I was assigned during the course of my experience. The First part will be about the introduction of the project and the work done on the admittedly library, maintaining the code base and writing the test suits. The work carried out is more connected to the Software engineer role, developing features, fixing bugs and testing. The second part will describe the experiments done on the Anomaly detection task using a Deep Learning technique called Autoencoder, this task is on the other hand more connected to the data science role. The two tasks were not done simultaneously but were dealt with one after the other, which is why I preferred to divide them into two separate parts of this paper.

Progetto e implementazione di software di segmentazione assistita di immagini mediche e predizione di biomarkers

La segmentazione prevede la partizione di un'immagine in aree strutturalmente o semanticamente coerenti. Nell'imaging medico, è utilizzata per identificare, contornandole, Regioni di Interesse (ROI) clinico, quali lesioni tumorali, oggetto di approfondimento tramite analisi semiautomatiche e automatiche, o bersaglio di trattamenti localizzati. La segmentazione di lesioni tumorali, assistita o automatica, consiste nell’individuazione di pixel o voxel, in immagini o volumi, appartenenti al tumore. La tecnica assistita prevede che il medico disegni la ROI, mentre quella automatica è svolta da software addestrati, tra cui i sistemi Computer Aided Detection (CAD). Mediante tecniche di visione artificiale, dalle ROI si estraggono caratteristiche numeriche, feature, con valore diagnostico, predittivo, o prognostico. L’obiettivo di questa Tesi è progettare e sviluppare un software di segmentazione assistita che permetta al medico di disegnare in modo semplice ed efficace una o più ROI in maniera organizzata e strutturata per futura elaborazione ed analisi, nonché visualizzazione. Partendo da Aliza, applicativo open-source, visualizzatore di esami radiologici in formato DICOM, è stata estesa l’interfaccia grafica per gestire disegno, organizzazione e memorizzazione automatica delle ROI. Inoltre, è stata implementata una procedura automatica di elaborazione ed analisi di ROI disegnate su lesioni tumorali prostatiche, per predire, di ognuna, la probabilità di cancro clinicamente non-significativo e significativo (con prognosi peggiore). Per tale scopo, è stato addestrato un classificatore lineare basato su Support Vector Machine, su una popolazione di 89 pazienti con 117 lesioni (56 clinicamente significative), ottenendo, in test, accuratezza = 77%, sensibilità = 86% e specificità = 69%. Il sistema sviluppato assiste il radiologo, fornendo una seconda opinione, non vincolante, adiuvante nella definizione del quadro clinico e della prognosi, nonché delle scelte terapeutiche.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Vertical Bone Measurements From Cone Beam Computed Tomography Images Using Different Software Packages.

This article aimed at comparing the accuracy of linear measurement tools of different commercial software packages. Eight fully edentulous dry mandibles were selected for this study. Incisor, canine, premolar, first molar and second molar regions were selected. Cone beam computed tomography (CBCT) images were obtained with i-CAT Next Generation. Linear bone measurements were performed by one observer on the cross-sectional images using three different software packages: XoranCat®, OnDemand3D® and KDIS3D®, all able to assess DICOM images. In addition, 25% of the sample was reevaluated for the purpose of reproducibility. The mandibles were sectioned to obtain the gold standard for each region. Intraclass coefficients (ICC) were calculated to examine the agreement between the two periods of evaluation; the one-way analysis of variance performed with the post-hoc Dunnett test was used to compare each of the software-derived measurements with the gold standard. The ICC values were excellent for all software packages. The least difference between the software-derived measurements and the gold standard was obtained with the OnDemand3D and KDIS3D (-0.11 and -0.14 mm, respectively), and the greatest, with the XoranCAT (+0.25 mm). However, there was no statistical significant difference between the measurements obtained with the different software packages and the gold standard (p> 0.05). In conclusion, linear bone measurements were not influenced by the software package used to reconstruct the image from CBCT DICOM data.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influence of dental metallic artifact from multislice CT in the assessment of simulated mandibular lesions

OBJECTIVE: This study evaluated the influence of metallic dental artifacts on the accuracy of simulated mandibular lesion detection by using multislice technology. MATERIAL AND METHODS: Fifteen macerated mandibles were used. Perforations were done simulating bone lesions and the mandibles were subjected to axial 16 rows multislice CT images using 0.5 mm of slice thickness with 0.3 mm interval of reconstruction. Metallic dental restorations were done and the mandibles were subjected again to CT in the same protocol. The images were analyzed to detect simulated lesions in the mandibles, verifying the loci number and if there was any cortical perforation exposing medullar bone. The analysis was performed by two independent examiners using e-film software. RESULTS: The samples without artifacts presented better results compared to the gold standard (dried mandible with perforations). In the samples without artifacts, all cortical perforation were identified and 46 loci were detected (of 51) in loci number analysis. Among the samples with artifacts, 12 lesions out of 14 were recognized regarding medullar invasion, and 40 out of 51 concerning loci number. The sensitivity in samples without artifacts was 90% and 100% regarding loci number and medullar invasion, respectively. In samples with artifacts, these values dropped to 78% and 86%, respectively. The presence of metallic restorations affected the sensitivity values of the method, but the difference was not significant (p>0.05). CONCLUSIONS: Although there were differences in the results of samples with and without artifacts, the presence of metallic restoration did not lead to misinterpretation of the final diagnosis. However, the validity of multislice CT imaging in this study was established for detection of simulated mandibular bone lesions.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.