A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine.

Several polycations possessing substantial buffering capacity below physiological pH, such as lipopolyamines and polyamidoamine polymers, are efficient transfection agents per se--i.e., without the addition of cell targeting or membrane-disruption agents. This observation led us to test the cationic polymer polyethylenimine (PEI) for its gene-delivery potential. Indeed, every third atom of PEI is a protonable amino nitrogen atom, which makes the polymeric network an effective "proton sponge" at virtually any pH. Luciferase reporter gene transfer with this polycation into a variety of cell lines and primary cells gave results comparable to, or even better than, lipopolyamines. Cytotoxicity was low and seen only at concentrations well above those required for optimal transfection. Delivery of oligonucleotides into embryonic neurons was followed by using a fluorescent probe. Virtually all neurons showed nuclear labeling, with no toxic effects. The optimal PEI cation/anion balance for in vitro transfection is only slightly on the cationic side, which is advantageous for in vivo delivery. Indeed, intracerebral luciferase gene transfer into newborn mice gave results comparable (for a given amount of DNA) to the in vitro transfection of primary rat brain endothelial cells or chicken embryonic neurons. Together, these properties make PEI a promising vector for gene therapy and an outstanding core for the design of more sophisticated devices. Our hypothesis is that its efficiency relies on extensive lysosome buffering that protects DNA from nuclease degradation, and consequent lysosomal swelling and rupture that provide an escape mechanism for the PEI/DNA particles.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription.

A gene therapy strategy using a transcription factor decoy of the E2F binding site inhibits smooth muscle proliferation in vivo.

The application of DNA technology to regulate the transcription of disease-related genes in vivo has important therapeutic potentials. The transcription factor E2F plays a pivotal role in the coordinated transactivation of cell cycle-regulatory genes such as c-myc, cdc2, and the gene encoding proliferating-cell nuclear antigen (PCNA) that are involved in lesion formation after vascular injury. We hypothesized that double-stranded DNA with high affinity for E2F may be introduced in vivo as a decoy to bind E2F and block the activation of genes mediating cell cycle progression and intimal hyperplasia after vascular injury. Gel mobility-shift assays showed complete competition for E2F binding protein by the E2F decoy. Transfection with E2F decoy inhibited expression of c-myc, cdc2, and the PCNA gene as well as vascular smooth muscle cell proliferation both in vitro and in the in vivo model of rat carotid injury. Furthermore, 2 weeks after in vivo transfection, neointimal formation was significantly prevented by the E2F decoy, and this inhibition continued up to 8 weeks after a single transfection in a dose-dependent manner. Transfer of an E2F decoy can therefore modulate gene expression and inhibit smooth muscle proliferation and vascular lesion formation in vivo.

Transient transfection and expression of firefly luciferase in Giardia lamblia.

We have developed a gene transfer system for the protozoan parasite Giardia lamblia. This organism is responsible for many cases of diarrhea worldwide and is considered to be one of the most primitive eukaryotes. Expression of a heterologous gene was detected in this parasite after electroporation with appropriate DNA constructs. We constructed a series of transfection plasmids using flanking sequences of the Giardia glutamate dehydrogenase (GDH) gene to drive expression of the firefly luciferase reporter gene. The optimal construct consisted of a GDH/luciferase fusion gene in which the first 18 codons of the GDH gene immediately preceded the luciferase gene; this fusion gene was flanked by the upstream and downstream sequences of the GDH gene. Electroporation of this construct into Giardia yielded luciferase activity that was 3000- to 50,000-fold above background. Removal of either the 5' or 3' GDH flanking sequences from this construct resulted in significantly reduced luciferase activity, and removal of both flanking sequences reduced luciferase activity to background levels. Luciferase activity was proportional to the amount of DNA electroporated and was maximal at 6 hr after electroporation.

A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidemia and low LPL activity.

We have identified a naturally occurring mutation in the promoter of the lipoprotein lipase (LPL) gene. One of 20 patients with familial combined hyperlipidemia (FCHL) and reduced levels of postheparin plasma LPL activity was found to be a heterozygote carrier of this mutation. The mutation, a T-->C substitution at nt -39, occurred in the binding site of the transcription factor Oct-1. As a result, the transcriptional activity of the mutant promoter was < 15% of wild type, as determined by transfection studies in the human macrophage-like cell line THP-1. This decrease in promoter activity was observed in undifferentiated as well as in phorbol ester-differentiated THP-1 cells. Furthermore, the inductive effect of elevating the levels of intracellular cAMP was equally reduced. This mutation was not present among 20 FCHL patients with normal plasma LPL levels nor has it been reported among individuals with familial LPL deficiency. Thus, heterozygosity for LPL promoter mutations may be one of several factors that contribute to the etiology of FCHL.

Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor alpha is mediated by NF-kappa B proteins.

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Chronic myeloid leukemia gene therapy delivered by cell penetrating peptides : from bench to clinic

Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2014

Non-Viral Gene Therapy to Cells of the bovine Intervertebral Disc

Background. Low back pain is an increasing global health problem, which is associated with intervertebral disc (IVD) damage and degeneration. Major changes occur in the nucleus pulposus (NP), with the degradation of the extracellular matrix (ECM).1 Further studies showed that growth factors from transforming growth factor β (TGFβ) and bone morphogenic proteins (BMP) family may induce chondrogenic differentiation of mesenchymal stem cells (MSC).2 Focusing on non-viral gene therapies and their possible translation into the clinics, we investigated if GDF6 (syn. BMP13 or CDMP2) can induce regeneration of degraded NP. We hypothesized that IVD transfected with plasmid over-expressing GDF6 also up-regulates other NP- and chondrogenic cell markers and enhances ECM deposition. Methods. Bovine nucleus pulposus (bNPC) and annulus fibrosus cells (bAFC) were harvested from bovine coccygeal IVD. Primary cells were then electroporized with plasmid GDF6 (Origene, vector RG211366) by optimizing parameters using the Neon Transfection system (Life Technologies, Basel). After transfection, cells were cultured in 2D monolayer or 3D alginate beads for 7, 14 or 21 days. Transfection efficiency of pGDF6 was analyzed by immunohistochemistry and fluorescent microscopy. Cell phenotype was quantified by real-time RT-PCR. To test a non-viral gene therapy applied directly to 3D whole organ culture, coccygeal bovine IVDs were harvested as previously described. Bovine IVDs were transfected by injection of plasmid GDF6 into the center. Electroporation was performed with ECM830 Square Wave Electroporation System (Harvard Apparatus, MA) using 2-needle array electrode or tweezertrodes. 72 h after tranfection discs were fixed and cryosectioned and analyzed by immunofluorescence against GDF6. Results. RT-PCR and immunohistochemistry confirmed up-regulation of GFP and GDF6 in the primary bNPC/bAFC culture. The GFP-tagged GDF6 protein, however, was not visible, possibly due to failure of dimer formation as a result of fusion structure. Organ IVD culture transfection revealed GDF6 positive staining in the center of the disc using 2-needle array electrode. Results from tweezertrodes did not show any GDF6 positive cells. Conclusion. Non-viral transfection is an appealing approach for gene therapy as it fulfills the translational safety aspects of transiency and lacks the toxic effects of viral transduction. We identified novel parameters to successfully transfect primary bovine IVD cells. For transfection of whole IVD explants electroporation parameters need to be further optimized. Acknowledgements. This project was funded by the Lindenhof Foundation (Funds “Research & Teaching”) Project no. 13-02-F. The imaging part of this study was performed with the facility of the Microscopy Imaging Center (MIC), University of Bern. References. Roughly PJ (2004): Spine (Phila), 29:2691-2699 Clarke LE, McConell JC, Sherratt MJ, Derby B, Richardson SM, Hoyland JA (2014), Arthritis Research & Therapy, 16:R67

Engineering mRNA translation initiation to enhance transient gene expression in Chinese hamster ovary cells

To increase transient expression of recombinant proteins in Chinese hamster ovary cells, we have engineered their protein synthetic capacity by directed manipulation of mRNA translation initiation. To control this process we constructed a nonphosphorylatable Ser51Ala site-directed mutant of eIF2, a subunit of the trimeric eIF2 complex that is implicated in regulation of the global rate of mRNA translation initiation in eukaryotic cells. Phosphorylation of eIF2 by protein kinases inhibits eIF2 activity and is known to increase as cells perceive a range of stress conditions. Using single-and dual-gene plasmids introduced into CHO cells by electroporation, we found that transient expression of the eIF2 Ser51Ala mutant with firefly luciferase resulted in a 3-fold increase in reporter activity, relative to cells transfected with reporter only. This effect was maintained in transfected cells for at least 48 h after transfection. Expression of the wild-type eIF2 protein had no such effect. Elevated luciferase activity was associated with a reduction in the level of eIF2 phosphorylation in cells transfected with the mutant eIF2 construct. Transfection of CHO cells with the luciferase-only construct resulted in a marked decrease in the global rate of protein synthesis in the whole cell population 6 h post-transfection. However, expression of the mutant Ser51Ala or wild-type eIF2 proteins restored the rate of protein synthesis in transfected cells to a level equivalent to or exceeding that of control cells. Associated with this, entry of plasmid DNA into cells during electroporation was visualized by confocal microscopy using a rhodamine-labeled plasmid construct expressing green fluorescent protein. Six hours after transfection, plasmid DNA was present in all cells, albeit to a variable extent. These data suggest that entry of naked DNA into the cell itself functions to inhibit protein synthesis by signaling mechanisms affecting control of mRNA translation by eIF2. This work therefore forms the basis of a rational strategy to generically up-regulate transient expression of recombinant proteins by simultaneous host cell engineering.

Gene codon composition determines differentiation-dependent expression of a viral capsid gene in keratinocytes in vitro and in vivo

By establishing mouse primary keratinocytes (KCs) in culture, we were able, for the first time, to express papillomavirus major capsid (L1) proteins by transient transfection of authentic or codon-modified L1 gene expression plasmids. We demonstrate in vitro and in vivo that gene codon composition is in part responsible for differentiation-dependent expression of L1 protein in KCs. L1 mRNA was present in similar amounts in differentiated and undifferentiated KCs transfected with authentic or codon-modified L1 genes and had a similar half-life, demonstrating that L1 protein production is posttranscriptionally regulated. We demonstrate further that KCs substantially change their tRNA profiles upon differentiation. Aminoacyl-tRNAs from differentiated KCs but not undifferentiated KCs enhanced the translation of authentic L1 mRNA, suggesting that differentiation-associated change to tRNA profiles enhances L1 expression in differentiated KCs. Thus, our data reveal a novel mechanism for regulation of gene expression utilized by a virus to direct viral capsid protein expression to the site of virion assembly in mature KCs. Analysis of two structural proteins of KCs, involucrin and keratin 14, suggests that translation of their mRNAs is also regulated, in association with KC differentiation in vitro, by a similar mechanism

Characterization of two polymorphisms in the leukotriene C4 synthase gene in an Australian population of subjects with mild, moderate, and severe asthma

Background: The cysteinyl-leukotrienes (cys-LTs) are proinflammatory mediators that are important in the pathophysiology of asthma. LTC4 synthase is a key enzyme in the cys-LT biosynthetic pathway, and studies in small populations have suggested that a promoter polymorphism (A(-444)C) in the gene might be associated with asthma severity and aspirin intolerance. Objective: We sought to screen the LTC4 synthase gene for polymorphisms and to determine whether there is an association between these polymorphisms and asthma severity or aspirin sensitivity in a large, well-phenotyped population and to determine whether this polymorphism is functionally relevant. Methods: The coding regions of the LTC4 synthase gene were screened for polymorphisms and the A(-444)C polymorphism was analyzed in a large Australian white adult population of mild (n = 282), moderate (n = 236), and severe asthmatic subjects (n = 86) and nonasthmatic subjects (n = 458), as well as in aspirin-intolerant asthmatic subjects (n = 67). The functional activity of the promoter polymorphism was investigated by transient transfection of HL-60 cells with a promoter construct. Results: A new polymorphism was identified in intron 1 of the gene (IVS1-10c>a) but was not associated with asthma. Association studies showed that the A(-444)C polymorphism was weakly associated with asthma per se, but there was no association between the C-444 allele and chronic asthma severity or aspirin intolerance. A meta-analysis of all the genetic studies conducted to date found significant between-study heterogeneity in C-444 allele frequencies within different clinical subgroups. In vitro functional studies showed no significant differences in transcription efficiency between constructs containing the A(-444) allele or the C-444 allele. Conclusions: Our data confirm that, independent of transcriptional activity, the C-444 allele in the LTC4 synthase gene is weakly associated with the asthma phenotype, but it is not related to disease severity or aspirin intolerance.

The Renilla luciferase gene as a reference gene for normalization of gene expression in transiently transfected cells

Background: The importance of appropriate normalization controls in quantitative real-time polymerase chain reaction (qPCR) experiments has become more apparent as the number of biological studies using this methodology has increased. In developing a system to study gene expression from transiently transfected plasmids, it became clear that normalization using chromosomally encoded genes is not ideal, at it does not take into account the transfection efficiency and the significantly lower expression levels of the plasmids. We have developed and validated a normalization method for qPCR using a co-transfected plasmid.Results: The best chromosomal gene for normalization in the presence of the transcriptional activators used in this study, cadmium, dexamethasone, forskolin and phorbol-12-myristate 13-acetate was first identified. qPCR data was analyzed using geNorm, Normfinder and BestKeeper. Each software application was found to rank the normalization controls differently with no clear correlation. Including a co-transfected plasmid encoding the Renilla luciferase gene (Rluc) in this analysis showed that its calculated stability was not as good as the optimised chromosomal genes, most likely as a result of the lower expression levels and transfection variability. Finally, we validated these analyses by testing two chromosomal genes (B2M and ActB) and a co-transfected gene (Rluc) under biological conditions. When analyzing co-transfected plasmids, Rluc normalization gave the smallest errors compared to the chromosomal reference genes.Conclusions: Our data demonstrates that transfected Rluc is the most appropriate normalization reference gene for transient transfection qPCR analysis; it significantly reduces the standard deviation within biological experiments as it takes into account the transfection efficiencies and has easily controllable expression levels. This improves reproducibility, data validity and most importantly, enables accurate interpretation of qPCR data. © 2010 Jiwaji et al; licensee BioMed Central Ltd.

Reducible disulfide-based non-viral gene delivery systems

The design and synthesis of safe efficient non-viral vectors for gene delivery has attracted significant attention in recent years due primarily to the severe side-effect profile reported with the use of their viral counterparts. Previous experiments have revealed that the strong interaction between the carriers and nucleic acid may well hinder the release of the gene from the complex in the cytosol adversely affecting transfection efficiency. However, incorporating reducible disulfide bonds within the delivery systems themselves which are then cleaved in the glutathione-rich intracellular environment may help in solving this puzzle. This review focuses on recent development of these reducible carriers. The biological rationale and approaches to the synthesis of reducible vectors are discussed in detail. The in vitro and in vivo evaluations of reducible carriers are also summarized and it is evident that they offer a promising approach in non-viral gene delivery system design.