Modelling human behaviour and event detection from videos

Automatic analysis of human behaviour in large collections of videos is gaining interest, even more so with the advent of file sharing sites such as YouTube. However, challenges still exist owing to several factors such as inter- and intra-class variations, cluttered backgrounds, occlusion, camera motion, scale, view and illumination changes. This research focuses on modelling human behaviour for action recognition in videos. The developed techniques are validated on large scale benchmark datasets and applied on real-world scenarios such as soccer videos. Three major contributions are made. The first contribution is in the area of proper choice of a feature representation for videos. This involved a study of state-of-the-art techniques for action recognition, feature extraction processing and dimensional reduction techniques so as to yield the best performance with optimal computational requirements. Secondly, temporal modelling of human behaviour is performed. This involved frequency analysis and temporal integration of local information in the video frames to yield a temporal feature vector. Current practices mostly average the frame information over an entire video and neglect the temporal order. Lastly, the proposed framework is applied and further adapted to real-world scenario such as soccer videos. A dataset consisting of video sequences depicting events of players falling is created from actual match data to this end and used to experimentally evaluate the proposed framework.

Exploring Hidden Coherent Feature Groups and Temporal Semantics for Multimedia Big Data Analysis

Thanks to the advanced technologies and social networks that allow the data to be widely shared among the Internet, there is an explosion of pervasive multimedia data, generating high demands of multimedia services and applications in various areas for people to easily access and manage multimedia data. Towards such demands, multimedia big data analysis has become an emerging hot topic in both industry and academia, which ranges from basic infrastructure, management, search, and mining to security, privacy, and applications. Within the scope of this dissertation, a multimedia big data analysis framework is proposed for semantic information management and retrieval with a focus on rare event detection in videos. The proposed framework is able to explore hidden semantic feature groups in multimedia data and incorporate temporal semantics, especially for video event detection. First, a hierarchical semantic data representation is presented to alleviate the semantic gap issue, and the Hidden Coherent Feature Group (HCFG) analysis method is proposed to capture the correlation between features and separate the original feature set into semantic groups, seamlessly integrating multimedia data in multiple modalities. Next, an Importance Factor based Temporal Multiple Correspondence Analysis (i.e., IF-TMCA) approach is presented for effective event detection. Specifically, the HCFG algorithm is integrated with the Hierarchical Information Gain Analysis (HIGA) method to generate the Importance Factor (IF) for producing the initial detection results. Then, the TMCA algorithm is proposed to efficiently incorporate temporal semantics for re-ranking and improving the final performance. At last, a sampling-based ensemble learning mechanism is applied to further accommodate the imbalanced datasets. In addition to the multimedia semantic representation and class imbalance problems, lack of organization is another critical issue for multimedia big data analysis. In this framework, an affinity propagation-based summarization method is also proposed to transform the unorganized data into a better structure with clean and well-organized information. The whole framework has been thoroughly evaluated across multiple domains, such as soccer goal event detection and disaster information management.

Detection and Grading of Prostate Cancer in Temporal Enhanced Ultrasound using Convolutional Neural Networks

Prostate cancer is the most common non-dermatological cancer amongst men in the developed world. The current definitive diagnosis is core needle biopsy guided by transrectal ultrasound. However, this method suffers from low sensitivity and specificity in detecting cancer. Recently, a new ultrasound based tissue typing approach has been proposed, known as temporal enhanced ultrasound (TeUS). In this approach, a set of temporal ultrasound frames is collected from a stationary tissue location without any intentional mechanical excitation. The main aim of this thesis is to implement a deep learning-based solution for prostate cancer detection and grading using TeUS data. In the proposed solution, convolutional neural networks are trained to extract high-level features from time domain TeUS data in temporally and spatially adjacent frames in nine in vivo prostatectomy cases. This approach avoids information loss due to feature extraction and also improves cancer detection rate. The output likelihoods of two TeUS arrangements are then combined to form our novel decision support system. This deep learning-based approach results in the area under the receiver operating characteristic curve (AUC) of 0.80 and 0.73 for prostate cancer detection and grading, respectively, in leave-one-patient-out cross-validation. Recently, multi-parametric magnetic resonance imaging (mp-MRI) has been utilized to improve detection rate of aggressive prostate cancer. In this thesis, for the first time, we present the fusion of mp-MRI and TeUS for characterization of prostate cancer to compensates the deficiencies of each image modalities and improve cancer detection rate. The results obtained using TeUS are fused with those attained using consolidated mp-MRI maps from multiple MR modalities and cancer delineations on those by multiple clinicians. The proposed fusion approach yields the AUC of 0.86 in prostate cancer detection. The outcomes of this thesis emphasize the viable potential of TeUS as a tissue typing method. Employing this ultrasound-based intervention, which is non-invasive and inexpensive, can be a valuable and practical addition to enhance the current prostate cancer detection.

A novel CE microchip with micro pillars column & double-L injection design for Capacitance Coupled Contactless Conductivity detection technology

This novel capillary electrophoresis microchip, or also known as μTAS (micro total analysis system) was designed to separate complex aqueous based compounds, similar to commercial CE & microchip (capillary electrophoresis) systems, but more compact. This system can be potentially used for mobile/portable chemical analysis equipment. Un-doped silicon wafer & ultra-thin borofloat glass (Pyrex) wafers have been used to fabricate the device. Double-L injection feature, micro pillars column, bypass separation channel & hybrid- referenced C4D electrodes were designed to achieve a high SNR (signal to noise ratio), easy- separation, for a durable and reusable μTAS for CE use.

A Case Based Methodology for Problem Solving aiming at Knee Osteoarthritis Detection

Knee osteoarthritis is the most common type of arthritis and a major cause of impaired mobility and disability for the ageing populations. Therefore, due to the increasing prevalence of the malady, it is expected that clinical and scientific practices had to be set in order to detect the problem in its early stages. Thus, this work will be focused on the improvement of methodologies for problem solving aiming at the development of Artificial Intelligence based decision support system to detect knee osteoarthritis. The framework is built on top of a Logic Programming approach to Knowledge Representation and Reasoning, complemented with a Case Based approach to computing that caters for the handling of incomplete, unknown, or even self-contradictory information.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.