983 resultados para 3-JET EVENTS
Resumo:
Maxillofacial trauma resulting from falls in elderly patients is a major social and health care concern. Most of these traumatic events involve mandibular fractures. The aim of this study was to analyze stress distributions from traumatic loads applied on the symphyseal, parasymphyseal, and mandibular body regions in the elderly edentulous mandible using finite-element analysis (FEA). Computerized tomographic analysis of an edentulous macerated human mandible of a patient approximately 65 years old was performed. The bone structure was converted into a 3-dimensional stereolithographic model, which was used to construct the computer-aided design (CAD) geometry for FEA. The mechanical properties of cortical and cancellous bone were characterized as isotropic and elastic structures, respectively, in the CAD model. The condyles were constrained to prevent free movement in the x-, y-, and z-axes during simulation. This enabled the simulation to include the presence of masticatory muscles during trauma. Three different simulations were performed. Loads of 700 N were applied perpendicular to the surface of the cortical bone in the symphyseal, parasymphyseal, and mandibular body regions. The simulation results were evaluated according to equivalent von Mises stress distributions. Traumatic load at the symphyseal region generated low stress levels in the mental region and high stress levels in the mandibular neck. Traumatic load at the parasymphyseal region concentrated the resulting stress close to the mental foramen. Traumatic load in the mandibular body generated extensive stress in the mandibular body, angle, and ramus. FEA enabled precise mapping of the stress distribution in a human elderly edentulous mandible (neck and mandibular angle) in response to 3 different traumatic load conditions. This knowledge can help guide emergency responders as they evaluate patients after a traumatic event.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use
Resumo:
Objective: To determine whether information from genetic risk variants for diabetes is associated with cardiovascular events incidence. Methods: From the about 30 known genes associated with diabetes, we genotyped single-nucleotide polymorphisms at the 10 loci most associated with type-2 diabetes in 425 subjects from the MASS-II Study, a randomized study in patients with multi-vessel coronary artery disease. The combined genetic information was evaluated by number of risk alleles for diabetes. Performance of genetic models relative to major cardiovascular events incidence was analyzed through Kaplan-Meier curve comparison and Cox Hazard Models and the discriminatory ability of models was assessed for cardiovascular events by calculating the area under the ROC curve. Results: Genetic information was able to predict 5-year incidence of major cardiovascular events and overall-mortality in non-diabetic individuals, even after adjustment for potential confounders including fasting glycemia. Non-diabetic individuals with high genetic risk had a similar incidence of events then diabetic individuals (cumulative hazard of 33.0 versus 35.1% of diabetic subjects). The addition of combined genetic information to clinical predictors significantly improved the AUC for cardiovascular events incidence (AUC = 0.641 versus 0.610). Conclusions: Combined information of genetic variants for diabetes risk is associated to major cardiovascular events incidence, including overall mortality, in non-diabetic individuals with coronary artery disease.