Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Stimulating dormancy release and emergence of annual ryegrass (Lolium rigidum) seeds using short-term hydrated storage in darkness

Experiments were performed to determine whether the dormancy release effect of hydrated storage in darkness (dark-stratification) is common amongst annual ryegrass populations and has the potential to occur under field conditions. Dormant seeds from all populations tested (22) became sensitive to light during dark-stratification, enabling them to germinate when subsequently exposed to light. Under controlled temperature (25/15degreesC), light (12-h photoperiod), and hydration (solidified agar-water) conditions, more seeds germinated by 28 days if the first 14 days were in darkness followed by exposure to light for 12 h per day than if they were exposed to light throughout or darkness throughout. Constraint over the conditions imposed during dark-stratification and germination was gradually reduced to investigate whether the dormancy release effect was diminished. Dark-stratification was effective in promoting germination when performed under natural diurnal temperatures, and burial in moist soil provided suitable conditions for dark-stratification to occur. The surface of moist soil, with natural diurnal temperatures and sunlight, was suitable for germination of dark-stratified seeds. Dark-stratification is a quick and effective means to enhance the sensitivity of dormant annual ryegrass seeds to light, enabling the majority of the population to germinate. However, large quantities of light are required to promote germination of dark-stratified seeds, so buried seeds must be moved to the soil surface to allow exposure to adequate light for germination.

Short- and long-term, salinity-induced modulation of V-ATPase activity in the posterior gills of the true freshwater crab, Dilocarcinus pagei (Brachyura, Trichodactylidae)

To better understand the biochemical mechanisms underlying anisosmotic extracellular regulation in the freshwater Brachyura, we kinetically characterized the V-ATPase from the posterior gills of Dilocarcinus pagei, acclimated for 10 days to salinities up to 21%.. Specific activity was highest in fresh water (26.5 +/- 2.1 U mg(-1)), decreasing in 5 parts per thousand to 21 parts per thousand, attaining 3-fold less at 15 parts per thousand. Apparent affinities for ATP and Mg(2+) respectively increased 3.2- and 2-fold at 10 parts per thousand, suggesting expression of different isoenzymes. In a 240-h time-course study of exposure to 21%., maximum specific activity decreased 2.5- to 4-fold within 1 to 24 h while apparent affinities for ATP and Mg(2+) respectively increased by 12-fold within 24 h and 2.4-fold after 1 h, unchanged thereafter. K(I) for bafilomycin A(1) decreased 150-fold after 1 h, remaining constant up to 120 h. This is the first kinetic analysis of V-ATPase specific activity in crustacean gills during salinity acclimation. Our findings indicate active gill Cl(-) uptake by D. pagei in fresh water, and short- and long-term down-regulation of V-ATPase-driven ion uptake processes during salinity exposure, aiding in comprehension of the biochemical adaptations underpinning the establishment of the Brachyura in fresh water. (C) 2011 Elsevier Inc. All rights reserved.

Identification of novel non-autonomous CemaT transposable elements and evidence of their mobility within the C. elegans genome

We describe here two new transposable elements, CemaT4 and CemaT5, that were identified within the sequenced genome of Caenorhabditis elegans using homology based searches. Five variants of CemaT4 were found, all non-autonomous and sharing 26 bp inverted terminal repeats (ITRs) and segments (152-367 bp) of sequence with similarity to the CemaT1 transposon of C. elegans. Sixteen copies of a short, 30 bp repetitive sequence, comprised entirely of an inverted repeat of the first 15 bp of CemaT4's ITR, were also found, each flanked by TA dinucleotide duplications, which are hallmarks of target site duplications of mariner-Tc transposon transpositions. The CemaT5 transposable element had no similarity to maT elements, except for sharing identical ITR sequences with CemaT3. We provide evidence that CemaT5 and CemaT3 are capable of excising from the C. elegans genome, despite neither transposon being capable of encoding a functional transposase enzyme. Presumably, these two transposons are cross-mobilised by an autonomous transposon that recognises their shared ITRs. The excisions of these and other non-autonomous elements may provide opportunities for abortive gap repair to create internal deletions and/or insert novel sequence within these transposons. The influence of non-autonomous element mobility and structural diversity on genome variation is discussed.

Three-monthly intravitreal bevacizumab injections for neovascular age-related macular degeneration: short-term visual acuity results

PURPOSE. To evaluate the change in vision after 3 monthly consecutive intravitreal injections of 1.25 mg of bevacizumab for neovascular age-related macular degeneration (AMD). METHODS. A retrospective analysis of 35 eyes was performed. Visual acuity (VA) at initial visit and at each follow-up visit was compared. The injection of bevacizumab was performed at 30-day intervals and patients were observed for 5 months after the last injection. RESULTS. Of the 35 eyes, 9 had received previous treatment with photodynamic therapy with or without 4 mg of intravitreal triamcinolone. VA was measured in Snellen table and transformed into logMAR for statistical purposes. Mean age was 76.66 years (range, 49-90 years). There were 24(69%) women and 11(31%) men. Mean VA at the initial visit was 0.92 +/- 0.50. At month 1, mean VA was 0.84 +/- 0.51 and at month 2 was 0.74 +/- 0.51. At month 3, mean VA remained 0.74 +/- 0.49. Six and 8 months after the initial visit, VA was 0.79 +/- 0.49 and 0.77 +/- 0.50, respectively. The improvement in VA was statistically significant at month 2 and at the end of the follow-up (8 months) compared with the baseline VA. CONCLUSIONS. Three consecutive monthly injections of intravitreal bevacizumab to treat neovascular AMD is effective in improving VA in the short term. Longer prospective studies should be performed to confirm VA stability after the third injection. (Eur J Ophthalmol 2010; 20: 740-4)

Effectiveness of the Combined Recombinant Human Growth Hormone and Gonadotropin-Releasing Hormone Analog Therapy in Pubertal Patients with Short Stature due to SHOX Deficiency

Context: Isolated heterozygous SHOX defects are the most frequent monogenic cause of short stature, and combined therapy with recombinant human GH (rhGH) and GnRH analog (GnRHa) in pubertal patients has been suggested, but there are no data on final height. Objective: The aim of the study was to analyze adult height after rhGH and GnRHa therapy in patients with SHOX haploinsufficiency. Patients: Ten peripubertal patients with isolated SHOX defects participated in the study. Intervention: Five patients were followed without treatment, and five were treated with rhGH (50 mu g/kg/d) and depot leuprolide acetate (3.75 mg/month). Main Outcome Measures: Adult height SD score (SDS) was measured. Results: All patients followed without treatment had marked downward growth shift during puberty (height SDS, -1.2 +/- 0.7 at 11.4 +/- 1.4 yr; adult height SDS, -2.5 +/- 0.5). Conversely, four of five patients treated with rhGH for 2 to 4.9 yr associated to GnRHa for 1.4 to 5.8 yr improved their height SDS from -2.3 +/- 1.3 at 11.8 +/- 2.1 yr to a final height SDS of -1.7 +/- 1.6. The difference between the mean height SDS at the first evaluation and final height SDS was statistically significant in nontreated vs. treated patients (mean height SDS change, -1.2 +/- 0.4 vs. 0.6 +/- 0.4, respectively; P < 0.001). Conclusion: A gain in adult height of patients with isolated SHOX defects treated with combined rhGH and GnRHa therapy was demonstrated for the first time, supporting this treatment for children with SHOX defects who have just started puberty to avoid the loss of growth potential observed in these patients during puberty. (J Clin Endocrinol Metab 95: 328-332, 2010)

Could the Leukocyte X Chromosome Inactivation Pattern Be Extrapolated to Hair Bulbs?

Background: The androgen receptor gene is located on the X chromosome with a polymorphic tract of CAG repeats that is inversely correlated to the receptor`s transactivation activity. A short CAG tract is associated with hyperandrogenic disorders. In women, one of the X chromosomes is inactivated and the X chromosome inactivation (XCI) pattern varies among tissues. Previous studies of hyperandrogenic disorders only evaluated XCI in leukocytes. Objective: To evaluate whether the XCI pattern in leukocytes could be extrapolated to those in hair bulbs. Material: A total of 58 healthy women were used for this study. DNA was extracted from leukocytes (n = 58 women) and pubic (n = 53 women) and scalp hair (n = 21 women). Methods: Hpa II digested and undigested DNA samples underwent fluorescence PCR GeneScan (R) analysis. Results: A significant and positive correlation of XCI was found between leukocytes and hair bulbs. However, individual comparisons showed that 13 and 19% of the women presented a different leukocyte XCI pattern in pubic hair and similar in leukocytes and hair bulbs of normal women indicating that leukocyte DNA is useful for XCI analysis. However, the XCI pattern could vary among tissues from the same subject, indicating that care should be taken when extrapolating individual leukocyte XCI patterns to other tissue. Copyright (C) 2010 S. Karger AG, Basel

Analysis of the PTPN11 gene in idiopathic short stature children and Noonan syndrome patients

Background Mutations in the PTPN11 gene are the main cause of Noonan syndrome (NS). The presence of some NS features is a frequent finding in children with idiopathic short stature (ISS). These children can represent the milder end of the NS clinical spectrum and PTPN11 is a good candidate for involvement in the pathogenesis of ISS. Objective To evaluate the presence of mutations in PTPN11 in ISS children who presented NS-related signs and in well-characterized NS patients. Patients and methods We studied 50 ISS children who presented at least two NS-associated signs but did not fulfil the criteria for NS diagnosis. Forty-nine NS patients diagnosed by the criteria of van der Burgt et al. were used to assess the adequacy of these criteria to select patients for PTPN11 mutation screening. The coding region of PTPN11 was amplified by polymerase chain reaction (PCR), followed by direct sequencing. Results No mutations or polymorphisms were found in the coding region of the PTPN11 gene in ISS children. Nineteen of the 49 NS patients (39%) presented mutations in PTPN11. No single characteristic enabled us to distinguish between NS patients with or without PTPN11 mutations. Conclusion Considering that no mutations were found in the present cohort with NS-related signs, it is unlikely that mutations would be found in unselected ISS children. The van der Burgt et al. criteria are adequate in attaining NS diagnosis and selecting patients for molecular studies. Mutations in the PTPN11 gene are commonly involved in the pathogenesis of NS but are not a common cause of ISS.

Short-term and long-term cardiovascular actions of different doses of perindopril in the rabbit

Short-term (one week) and chronic (six week) cardiovascular effects of orally administered perindopril were examined in the rabbit to demonstrate if short-term results can predict chronic outcomes. In short-term treatment, five doses of perindopril were examined in random order separated by a one week recovery period in each of six rabbits. Two doses of perindopril which resulted in a moderate hypotensive effect (-14 mmHg) and no hypotensive effect, respectively, were then selected for long-term treatment. Each rabbit in the short-term study received perindopril in doses of 0.01, 0.06, 0.32, 1.8 and 10 mg kg(-1) day(-1) for a week at a time. Rabbits on long-term treatment received either 0.3 or 0.01 mg kg(-1) day(-1) perindopril for six weeks. All rabbits had their mean arterial blood pressure (MAP) and heart rate recorded throughout treatment. Plasma angiotensin I (AngI), perindoprilat, angiotensin converting enzyme (ACE) inhibition were also assayed. Perindopril treatment for one week produced a dose-dependent hypotensive effect with the threshold dose, 0.06 mg kg(-1) day(-1), producing a 6.5+/-1.8 mmHg fall in MAP. The highest dose (10.0 mg kg(-1) day(-1)) produced a large fall in blood pressure of -29.6+/-4.2 mmHg. The 0.01 and 0.06 mg kg(-1) day(-1) doses of perindopril produced an average 2.65 fold increase in plasma AngI levels compared to the initial control. The three higher doses (0.32-10.0 mg kg(-1) day(-1)) of perindopril produced an equivalent 5.7 fold increase in plasma AngI levels compared to the initial controls. However, over six weeks 0.01 mg kg(-1) day(-1) perindopril induced a similar decrease in MAP as the 30 fold higher dose (-9.3 mmHg compared to -11.7 mmHg,). This was in spite of a 3 fold difference in plasma perindoprilat concentrations between the high and low dose perindopril groups. Plasma ACE inhibition was >80% with both doses of perindopril. The results indicate that while perindopril decreases MAP in a dose-dependent manner in short-term (one week) periods, over longer treatment times (six weeks) low concentrations of perindopril, non-hypotensive with shortterm treatment, may be as anti-hypertensive as considerably higher doses. (C) 1996 The Italian Pharmacological Society.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Lung Diffusing Capacity Relates Better to Short-Term Progression on HRCT Abnormalities Than Spirometry in Mild Asbestosis

Background Pulmonary function tests (PFT), particularly spirometry and lung diffusing capacity for carbon monoxide (DL(CO)), have been considered useful methods for the detection of the progression of interstitial asbestos abnormalities as indicated by high-resolution computed tomography (HRCT). However, it is currently unknown which of these two tests correlates best with anatomical changes over time. Methods In this study, we contrasted longitudinal changes (3-9 years follow-up) in PFTs at rest and during exercise with interstitial abnormalities evaluated by HRCT in 63 ex-workers with mild-to-moderate asbestosis. Results At baseline, patients presented with low-grade asbestosis (Huuskonen classes I-II), and most PFT results were within the limits of normality. In the follow-up, most subjects had normal spirometry, static lung volumes and arterial blood gases. In contrast, frequency of DL(CO) abnormalities almost doubled (P < 0.05). Twenty-three (36.5%) subjects increased the interstitial marks on HRCT. These had significantly larger declines in DL(CO) compared to patients who remained stable (0.88 vs. 0.31 ml/min/mm Hg/year and 3.5 vs. 1.2%/year, respectively; P < 0.05). In contrast, no between-group differences were found for the other functional tests, including spirometry (P > 0.05). Conclusions These data demonstrate that the functional consequences of progression of HRCT abnormalities in mild-to-moderate asbestosis are better reflected by decrements in DL(CO) than by spirometric changes. These results might have important practical implications for medico-legal evaluation of this patient population. Am. J. Ind. Med. 54:185-193, 2011. (c) 2010 Wiley-Liss, Inc.

The relationship between body mass index and the variation in plasma levels of triglycerides after short-term red wine consumption

BACKGROUND: Alcoholic beverages may have protective cardiovascular effects but are known to increase the plasma levels of triglycerides (TG). Both TG and the ratio of TO to high-density lipoprotein cholesterol (TG/HDL-cholesterol) are associated with increased cardiovascular risk. OBJECTIVES: To determine the predictive factors for variations in plasma levels of TO and the TG/HDL-cholesterol ratio in patients after they had consumed red wine for 14 days. METHODS: Forty-two subjects (64% men, 46 +/- 9 years, baseline body mass index [BMI] 25.13 +/- 2.76 kg/m(2)) were given red wine (12% or 12.2% alc/vol, 250 mL/day with meals). Plasma concentration of lipids and glucose were measured before and after red wine consumption. Blood was collected after 12 hours of fast and alcohol abstention. RESULTS: Red wine increased plasma levels of TO from 105 +/- 42 mg/dL to 120 +/- 56 mg/dL (P = .001) and the TG/HDL-cholesterol ratio from 2.16 +/- 1.10 to 2.50 +/- 1.66 (P = .014). In a multivariate linear regression model that included age, baseline BMI, blood pressure, lipids, and glucose, only BMI was independently predictive of the variation in plasma TO after red wine (beta coefficient 0.592, P < .001). BMI also predicted the variation in TG/HDL-cholesterol ratio (beta coefficient 0.505, P = .001, adjusted model). When individuals were divided into three categories, according to their BMI, the average percentage variation in TG after red wine was -4%, 17%, and 33% in the lower (19.60-24.45 kg/m(2)), intermediate, and greater (26.30-30.44 kg/m(2)) tertiles, respectively (P = .001). CONCLUSIONS: Individuals with higher BMI, although nonobese, might be at greater risk for elevation in plasma TO levels and the TG/HDL-cholesterol ratio after short-term red wine consumption. (C) 2011 National Lipid Association. All rights reserved.

Short-term specialized enteral diet fails to attenuate malnutrition impairment of experimental open wound acute healing

Objective: We assessed the effect of enteral refeeding on the morphology, gene expression, and contraction of acute open wounds in previously malnourished rats using two different enteral diets. Methods: Adult male isogenic Lewis rats divided into two groups (eutrophic, n = 30; and previously malnourished, 12-15% body weight loss, n = 27) were subjected to cutaneous dorsal wounds and gastrostomy. Control rats received a standard oral diet (AIN-93M chow) plus enteral saline solution. Subject rats received chow plus a standard enteral diet or an enteral diet enriched with arginine and antioxidants. On post-trauma days 7 and 14, wound granulation tissue samples were collected for morphologic analysis using hematoxylin and eosin and picrosirius stain or immunohistochemistry slides and real-time polymerase chain reaction for collagen I and III gene expression. Wound contraction was also evaluated by comparing wound images from days 0,7, and 14. Results: Malnourished control rats had increased intensity and duration of wound inflammation, impaired increase of fibroblast cells contingent on post-trauma days 7 to 14, decreased expression of collagen III, and less wound contraction compared with eutrophic control rats. A specialized enteral diet did not improve wound healing of malnourished rats but did promote wound contraction at post-trauma day 7 in eutrophic rats. Conclusion: Short-term enteral refeeding, even with a specialized diet, failed to protect previously wounded malnourished rats from a prolonged inflammatory phase and impaired healing. (C) 2010 Elsevier Inc. All rights reserved.