IL-21 restricts virus-driven Treg cell expansion in chronic LCMV infection

Foxp3+ regulatory T (Treg) cells are essential for the maintenance of immune homeostasis and tolerance. During viral infections, Treg cells can limit the immunopathology resulting from excessive inflammation, yet potentially inhibit effective antiviral T cell responses and promote virus persistence. We report here that the fast-replicating LCMV strain Docile triggers a massive expansion of the Treg population that directly correlates with the size of the virus inoculum and its tendency to establish a chronic, persistent infection. This Treg cell proliferation was greatly enhanced in IL-21R-/- mice and depletion of Treg cells partially rescued defective CD8+ T cell cytokine responses and improved viral clearance in some but not all organs. Notably, IL-21 inhibited Treg cell expansion in a cell intrinsic manner. Moreover, experimental augmentation of Treg cells driven by injection of IL-2/anti-IL-2 immune complexes drastically impaired the functionality of the antiviral T cell response and impeded virus clearance. As a consequence, mice became highly susceptible to chronic infection following exposure to low virus doses. These findings reveal virus-driven Treg cell proliferation as potential evasion strategy that facilitates T cell exhaustion and virus persistence. Furthermore, they suggest that besides its primary function as a direct survival signal for antiviral CD8+ T cells during chronic infections, IL-21 may also indirectly promote CD8+ T cell poly-functionality by restricting the suppressive activity of infection-induced Treg cells.

Cell Cycle Regulatory Roles of Estrogen Receptor alpha (ERα) in Breast Cancer Cells

Previous studies have shown that Estrogen Receptor alpha (ERα) is an important indicator for diagnosis, prognosis and treatment of breast cancers. However, the question remains as to the role of ERα in the cell in the presence versus absence of 17-β estradiol In this dissertation the role of ERα in both its unliganded and liganded state, with respect to the cell cycle will be explored. The cell line models used in this project are ER-positive MCF-7 cells with and without siRNA to ERα and ER-positive MDA-MB-231 cells that have been engineered to express ERα. Cells were synchronized and the cell cycle progression was monitored by flow cytometric analysis. Using these methods, two specific questions were addressed: Does ERα modulate the cell cycle differently under liganded versus unliganded conditions? And, does the presence of ERα regulate cell cycle phase transitions? The results show for the first time that ERα is cell cycle regulated and modulates the progression of cells through S and G2/M phases of the cell cycle. Ligand bound ERα increases progression through S and G2/M phases, whereas unliganded ERα acts as an inhibitor of cell cycle progression. To further investigate the cell cycle regulated effects of liganded ERα, a luciferase assay was performed and showed that the transcription of target genes such as Progestrone Receptor (PgR) and Trefoil protein (pS2) increased duing S and G2/M phases when ERα is bound to ligand. Additionally, complex formation between cyclin B and ER α was shown by immunoprecipitation and led to the discovery that anaphase promoting complex (APC) is the E3 ligase for both cyclin B and ERα at the termination of M phase. Our findings suggest that unliganded ERα has an inhibitory effect on the progression of the cell cycle. Therefore, it is reasonable to speculate that the combination of drugs that lower estrogen level (such as aromatase inhibitors) and preserves ERα from degradation would provide better outcome for breast cancer treatment. We have shown that APC functions as the E3 ligase for ERα and thus might provide a target to design a specific inhibitor of ERα degradation.

T cell vaccination induces T cell receptor Vβ-specific Qa-1-restricted regulatory CD8+ T cells

Vaccination of mice with activated autoantigen-reactive CD4+ T cells (T cell vaccination, TCV) has been shown to induce protection from the subsequent induction of a variety of experimental autoimmune diseases, including experimental allergic encephalomyelitis (EAE). Although the mechanisms involved in TCV-mediated protection are not completely known, there is some evidence that TCV induces CD8+ regulatory T cells that are specific for pathogenic CD4+ T cells. Previously, we demonstrated that, after superantigen administration in vivo, CD8+ T cells emerge that preferentially lyse and regulate activated autologous CD4+ T cells in a T cell receptor (TCR) Vβ-specific manner. This TCR Vβ-specific regulation is not observed in β2-microglobulin-deficient mice and is inhibited, in vitro, by antibody to Qa-1. We now show that similar Vβ8-specific Qa-1-restricted CD8+ T cells are also induced by TCV with activated CD4+ Vβ8+ T cells. These CD8+ T cells specifically lyse murine or human transfectants coexpressing Qa-1 and murine TCR Vβ8. Further, CD8+ T cell hybridoma clones generated from B10.PL mice vaccinated with a myelin basic protein-specific CD4+Vβ8+ T cell clone specifically recognize other CD4+ T cells and T cell tumors that express Vβ8 and the syngeneic Qa-1a but not the allogeneic Qa-1b molecule. Thus, Vβ-specific Qa-1-restricted CD8+ T cells are induced by activated CD4+ T cells. We suggest that these CD8+ T cells may function to specifically regulate activated CD4+ T cells during immune responses.

Phosphatidylcholine Synthesis Influences the Diacylglycerol Homeostasis Required for Sec14p-dependent Golgi Function and Cell Growth

Phosphatidylcholine and phosphatidylethanolamine are the most abundant phospholipids in eukaryotic cells and thus have major roles in the formation and maintenance of vesicular membranes. In yeast, diacylglycerol accepts a phosphocholine moiety through a CPT1-derived cholinephosphotransferase activity to directly synthesize phosphatidylcholine. EPT1-derived activity can transfer either phosphocholine or phosphoethanolamine to diacylglcyerol in vitro, but is currently believed to primarily synthesize phosphatidylethanolamine in vivo. In this study we report that CPT1- and EPT1-derived cholinephosphotransferase activities can significantly overlap in vivo such that EPT1 can contribute to 60% of net phosphatidylcholine synthesis via the Kennedy pathway. Alterations in the level of diacylglycerol consumption through alterations in phosphatidylcholine synthesis directly correlated with the level of SEC14-dependent invertase secretion and affected cell viability. Administration of synthetic di8:0 diacylglycerol resulted in a partial rescue of cells from SEC14-mediated cell death. The addition of di8:0 diacylglycerol increased di8:0 diacylglycerol levels 20–40-fold over endogenous long-chain diacylglycerol levels. Di8:0 diacylglcyerol did not alter endogenous phospholipid metabolic pathways, nor was it converted to di8:0 phosphatidic acid.

Rac and Cdc42 GTPases control hematopoietic stem cell shape, adhesion, migration, and mobilization

Critical to homeostasis of blood cell production by hematopoietic stem/progenitor (HSC/P) cells is the regulation of HSC/P retention within the bone marrow microenvironment and migration between the bone marrow and the blood. Key extracellular regulatory elements for this process have been defined (cell–cell adhesion, growth factors, chemokines), but the mechanism by which HSC/P cells reconcile multiple external signals has not been elucidated. Rac and related small GTPases are candidates for this role and were studied in HSC/P deficient in Rac2, a hematopoietic cell-specific family member. Rac2 appears to be critical for HSC/P adhesion both in vitro and in vivo, whereas a compensatory increase in Cdc42 activation regulates HSC/P migration. This genetic analysis provides physiological evidence of cross-talk between GTPase proteins and suggests that a balance of these two GTPases controls HSC/P adhesion and mobilization in vivo.

An essential regulatory role for macrophage migration inhibitory factor in T-cell activation.

The protein known as macrophage migration inhibitory factor (MIF) was one of the first cytokines to be discovered and was described 30 years ago to be a T-cell-derived factor that inhibited the random migration of macrophages in vitro. A much broader role for MIF has emerged recently as a result of studies that have demonstrated it to be released from the anterior pituitary gland in vivo. MIF also is the first protein that has been identified to be secreted from monocytes/macrophages upon glucocorticoid stimulation. Once released, MIF acts to "override" or counter-regulate the suppressive effects of glucocorticoids on macrophage cytokine production. We report herein that MIF plays an important regulatory role in the activation of T cells induced by mitogenic or antigenic stimuli. Activated T cells produce MIF and neutralizing anti-MIF antibodies inhibit T-cell proliferation and interleukin 2 production in vitro, and suppress antigen-driven T-cell activation and antibody production in vivo. T cells also release MIF in response to glucocorticoid stimulation and MIF acts to override glucocorticoid inhibition of T-cell proliferation and interleukin 2 and interferon gamma production. These studies indicate that MIF acts in concert with glucocorticoids to control T-cell activation and assign a previously unsuspected but critical role for MIF in antigen-specific immune responses.

Crystal structure of the cell cycle-regulatory protein suc1 reveals a beta-hinge conformational switch.

The Schizosaccharomyces pombe cell cycle-regulatory protein suc1, named as the suppressor of cdc2 temperature-sensitive mutations, is essential for cell cycle progression. To understand suc1 structure-function relationships and to help resolve conflicting interpretations of suc1 function based on genetic studies of suc1 and its functional homologs in both lower and higher eukaryotes, we have determined the crystal structure of the beta-interchanged suc1 dimer. Each domain consists of three alpha-helices and a four-stranded beta-sheet, completed by the interchange of terminal beta-strands between the two subunits. This beta-interchanged suc1 dimer, when compared with the beta-hairpin single-domain folds of suc1, reveals a beta-hinge motif formed by the conserved amino acid sequence HVPEPH. This beta-hinge mediates the subunit conformation and assembly of suc1: closing produces the intrasubunit beta-hairpin and single-domain fold, whereas opening leads to the intersubunit beta-strand interchange and interlocked dimer assembly reported here. This conformational switch markedly changes the surface accessibility of sequence-conserved residues available for recognition of cyclin-dependent kinase, suggesting a structural mechanism for beta-hinge-mediated regulation of suc1 biological function. Thus, suc1 belongs to the family of domain-swapping proteins, consisting of intertwined and dimeric protein structures in which the dual assembly modes regulate their function.

Opposing early and late effects of insulin-like growth factor I on differentiation and the cell cycle regulatory retinoblastoma protein in skeletal myoblasts.

The mechanisms by which insulin-like growth factors (IGFs) can be both mitogenic and differentiation-promoting in skeletal myoblasts are unclear because these two processes are believed to be mutually exclusive in this tissue. The phosphorylation state of the ubiquitous nuclear retinoblastoma protein (Rb) plays an important role in determining whether myoblasts proliferate or differentiate: Phosphorylated Rb promotes mitogenesis, whereas un- (or hypo-) phosphorylated Rb promotes cell cycle exit and differentiation. We hypothesized that IGFs might affect the fate of myoblasts by regulating the phosphorylation of Rb. Although long-term IGF treatment is known to stimulate differentiation, we find that IGFs act initially to inhibit differentiation and are exclusively mitogenic. These early effects of IGFs are associated with maintenance of Rb phosphorylation typical of proliferating cells; upregulation of the gene expression of cyclin-dependent kinase 4 and cyclin D1, components of a holoenzyme that plays a principal role in mediating Rb phosphorylation; and marked inhibition of the gene expression of myogenin, a member of the MyoD family of skeletal muscle-specific transcription factors that is essential in muscle differentiation. We also find that IGF-induced inhibition of differentiation occurs through a process that is independent of its mitogenic effects. We demonstrate, thus, that IGFs regulate Rb phosphorylation and cyclin D1 and cyclin-dependent kinase 4 gene expression; together with their biphasic effects on myogenin expression, these results suggest a mechanism by which IGFs are initially mitogenic and subsequently differentiation-promoting in skeletal muscle.

Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: implication of Ikaros and CBF binding sites in promoter activation.

Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Control of neuronal signalling pathways by CYP46A1, an enzime involved in brain cholesterol homeostasis

Tese de doutoramento, Farmácia (Biologia Celular e Molecular), Universidade de Lisboa, Faculdade de Farmácia, 2016

Regulatory T Cells Accumulate in the Lung Allergic Inflammation and Efficiently Suppress T-Cell Proliferation but Not Th2 Cytokine Production

Foxp3(+)CD25(+)CD4(+) regulatory T cells are vital for peripheral tolerance and control of tissue inflammation. In this study, we characterized the phenotype and monitored the migration and activity of regulatory T cells present in the airways of allergic or tolerant mice after allergen challenge. To induce lung allergic inflammation, mice were sensitized twice with ovalbumin/aluminum hydroxide gel and challenged twice with intranasal ovalbumin. Tolerance was induced by oral administration of ovalbumin for 5 consecutive days prior to OVA sensitization and challenge. We detected regulatory T cells (Foxp3(+)CD25(+)CD4(+) T cells) in the airways of allergic and tolerant mice; however, the number of regulatory T cells was more than 40-fold higher in allergic mice than in tolerant mice. Lung regulatory T cells expressed an effector/memory phenotype (CCR4(high)CD62L(low)CD44(high)CD54(high)CD69(+)) that distinguished them from naive regulatory T cells (CCR4(int)CD62L(high)CD44(int)CD54(int)CD69(-)). These regulatory T cells efficiently suppressed pulmonary T-cell proliferation but not Th2 cytokine production.

Active regulatory T-cells contribute to broadened T-cell repertoire diversity in ivIg-treated SLE patients

Octapharma.

Broadened T-cell Repertoire Diversity in ivIg-treated SLE Patients is Also Related to the Individual Status of Regulatory T-cells

Intravenous IgG (ivIg) is a therapeutic alternative for lupus erythematosus, the mechanism of which remains to be fully understood. Here we investigated whether ivIg affects two established sub-phenotypes of SLE, namely relative oligoclonality of circulating T-cells and reduced activity of CD4 + Foxp3+ regulatory T-cells (Tregs) reflected by lower CD25 surface density.

Multiple regulatory variants located in cell type-specific enhancers within the PKP2 locus form major risk and protective haplotypes for canine atopic dermatitis in German shepherd dogs.

BACKGROUND Canine atopic dermatitis (CAD) is a chronic inflammatory skin disease triggered by allergic reactions involving IgE antibodies directed towards environmental allergens. We previously identified a ~1.5 Mb locus on canine chromosome 27 associated with CAD in German shepherd dogs (GSDs). Fine-mapping indicated association closest to the PKP2 gene encoding plakophilin 2. RESULTS Additional genotyping and association analyses in GSDs combined with control dogs from five breeds with low-risk for CAD revealed the top SNP 27:19,086,778 (p = 1.4 × 10(-7)) and a rare ~48 kb risk haplotype overlapping the PKP2 gene and shared only with other high-risk CAD breeds. We selected altogether nine SNPs (four top-associated in GSDs and five within the ~48 kb risk haplotype) that spanned ~280 kb forming one risk haplotype carried by 35 % of the GSD cases and 10 % of the GSD controls (OR = 5.1, p = 5.9 × 10(-5)), and another haplotype present in 85 % of the GSD cases and 98 % of the GSD controls and conferring a protective effect against CAD in GSDs (OR = 0.14, p = 0.0032). Eight of these SNPs were analyzed for transcriptional regulation using reporter assays where all tested regions exerted regulatory effects on transcription in epithelial and/or immune cell lines, and seven SNPs showed allelic differences. The DNA fragment with the top-associated SNP 27:19,086,778 displayed the highest activity in keratinocytes with 11-fold induction of transcription by the risk allele versus 8-fold by the control allele (pdifference = 0.003), and also mapped close (~3 kb) to an ENCODE skin-specific enhancer region. CONCLUSIONS Our experiments indicate that multiple CAD-associated genetic variants located in cell type-specific enhancers are involved in gene regulation in different cells and tissues. No single causative variant alone, but rather multiple variants combined in a risk haplotype likely contribute to an altered expression of the PKP2 gene, and possibly nearby genes, in immune and epithelial cells, and predispose GSDs to CAD.