Optimization of quantum states for signaling across an arbitrary qubit noise channel with minimum-error detection

International audience

Detection of explosive vapors using organic thin-film transistors

Field effect transistors (FETs) based on organic materials were investigated as sensors for detecting 2,4,6-trinitrotoluene (TNT) vapors. Several FET devices were fabricated using two types of semiconducting organic materials, solution processed polymers deposited by spin coating and, oligomers (or small molecules) deposited by vacuum sublimation. When vapors of nitroaromatic compounds bind to thin films of organic materials which form the transistor channel, the conductivity of the thin film increases and changes the transistor electrical characteristic. The use of the amplifying properties of the transistor represents a major advantage over conventional techniques based on simple changes of resistance in polymers frequently used in electronic noses.

Detection and Grading of Prostate Cancer in Temporal Enhanced Ultrasound using Convolutional Neural Networks

Prostate cancer is the most common non-dermatological cancer amongst men in the developed world. The current definitive diagnosis is core needle biopsy guided by transrectal ultrasound. However, this method suffers from low sensitivity and specificity in detecting cancer. Recently, a new ultrasound based tissue typing approach has been proposed, known as temporal enhanced ultrasound (TeUS). In this approach, a set of temporal ultrasound frames is collected from a stationary tissue location without any intentional mechanical excitation. The main aim of this thesis is to implement a deep learning-based solution for prostate cancer detection and grading using TeUS data. In the proposed solution, convolutional neural networks are trained to extract high-level features from time domain TeUS data in temporally and spatially adjacent frames in nine in vivo prostatectomy cases. This approach avoids information loss due to feature extraction and also improves cancer detection rate. The output likelihoods of two TeUS arrangements are then combined to form our novel decision support system. This deep learning-based approach results in the area under the receiver operating characteristic curve (AUC) of 0.80 and 0.73 for prostate cancer detection and grading, respectively, in leave-one-patient-out cross-validation. Recently, multi-parametric magnetic resonance imaging (mp-MRI) has been utilized to improve detection rate of aggressive prostate cancer. In this thesis, for the first time, we present the fusion of mp-MRI and TeUS for characterization of prostate cancer to compensates the deficiencies of each image modalities and improve cancer detection rate. The results obtained using TeUS are fused with those attained using consolidated mp-MRI maps from multiple MR modalities and cancer delineations on those by multiple clinicians. The proposed fusion approach yields the AUC of 0.86 in prostate cancer detection. The outcomes of this thesis emphasize the viable potential of TeUS as a tissue typing method. Employing this ultrasound-based intervention, which is non-invasive and inexpensive, can be a valuable and practical addition to enhance the current prostate cancer detection.

An Islanding Detection Method based on Impedance Estimation and Grid Identification for Grid-Tie Distributed Power Generation Systems

Power system policies are broadly on track to escalate the use of renewable energy resources in electric power generation. Integration of dispersed generation to the utility network not only intensifies the benefits of renewable generation but also introduces further advantages such as power quality enhancement and freedom of power generation for the consumers. However, issues arise from the integration of distributed generators to the existing utility grid are as significant as its benefits. The issues are aggravated as the number of grid-connected distributed generators increases. Therefore, power quality demands become stricter to ensure a safe and proper advancement towards the emerging smart grid. In this regard, system protection is the area that is highly affected as the grid-connected distributed generation share in electricity generation increases. Islanding detection, amongst all protection issues, is the most important concern for a power system with high penetration of distributed sources. Islanding occurs when a portion of the distribution network which includes one or more distributed generation units and local loads is disconnected from the remaining portion of the grid. Upon formation of a power island, it remains energized due to the presence of one or more distributed sources. This thesis introduces a new islanding detection technique based on an enhanced multi-layer scheme that shows superior performance over the existing techniques. It provides improved solutions for safety and protection of power systems and distributed sources that are capable of operating in grid-connected mode. The proposed active method offers negligible non-detection zone. It is applicable to micro-grids with a number of distributed generation sources without sacrificing the dynamic response of the system. In addition, the information obtained from the proposed scheme allows for smooth transition to stand-alone operation if required. The proposed technique paves the path towards a comprehensive protection solution for future power networks. The proposed method is converter-resident and all power conversion systems that are operating based on power electronics converters can benefit from this method. The theoretical analysis is presented, and extensive simulation results confirm the validity of the analytical work.

Analysis and detection of partial discharges in an electric motor of a hybrid supercar.

The objective of this thesis was the development of a new detection method of partial discharge (PD) activity in the stator of an electrical hybrid supercar fed by a silicon carbide converter, for which detection with common methods make it very difficult to separate PD pulses from switching noise. This work focused on the analysis and detection of partial discharges making use of an antenna, a peak detector, and an oscilloscope capable of capturing the electromagnetic pulses emitted during PD activity. Validation of the proposed method was done by comparing the partial discharge inception voltage (PDIV) detected by this system with the one obtained from an optical method of proven accuracy, with different rise times and samples. Further development of this method, if proved successful on a full stator, can help increasing the overall reliability of the car, potentially allowing for real time detection of PD activity and predictive maintenance before failure of the insulation system in a hybrid vehicle.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.