Capacity limits for the detection of changing visual features

Capacity limits in visual attention have traditionally been studied using static arrays of elements from which an observer must detect a target defined by a certain visual feature or combination of features. In the current study we use this visual search paradigm, with accuracy as the dependent variable, to examine attentional capacity limits for different visual features undergoing change over time. In Experiment 1, detectability of a single changing target was measured under conditions where the type of change (size, speed, colour), the magnitude of change, the set size and homogeneity of the unchanging distractors were all systematically varied. Psychometric function slopes were calculated for different experimental conditions and ‘change thresholds’extracted from these slopes were used in Experiment 2, in which multiple supra-threshold changes were made, simultaneously, either to a single or to two or three different stimulus elements. These experiments give an objective psychometric paradigm for measuring changes in visual features over time. Results favour object-based accounts of visual attention, and show consistent differences in the allocation of attentional capacity to different perceptual dimensions.

The detection and identification of extraneous metals in material conveyance systems

The aim of this work was to design and build an equipment which can detect ferrous and non-ferrous objects in conveyed commodities, discriminate between them and locate the object along the belt and on the width of the belt. The magnetic induction mechanism was used as a means of achieving the objectives of this research. In order to choose the appropriate geometry and size of the induction field source, the field distributions of different source geometries and sizes were studied in detail. From these investigations it was found the square loop geometry is the most appropriate as a field generating source for the purpose of this project. The phenomena of field distribution in the conductors was also investigated. An equipment was designed and built at the preliminary stages of thework based on a flux-gate magnetometer with the ability to detect only ferrous objects.The instrument was designed such that it could be used to detect ferrous objects in the coal conveyors of power stations. The advantages of employing this detector in the power industry over the present ferrous metal electromagnetic separators were also considered. The objectives of this project culminated in the design and construction of a ferrous and non-ferrous detector with the ability to discriminate between ferrous and non-ferrous metals and to locate the objects on the conveying system. An experimental study was carried out to test the performance of the equipment in the detection of ferrous and non-ferrous objects of a given size carried on the conveyor belt. The ability of the equipment to discriminate between the types of metals and to locate the object on the belt was also evaluated experimentally. The benefits which can be gained from the industrial implementations of the equipment were considered. Further topics which may be investigated as an extension of this work are given.

Late development of metric part-relational processing in object recognition

Four experiments with unfamiliar objects examined the remarkably late consolidation of part-relational relative to part-based object recognition (Jüttner, Wakui, Petters, Kaur, & Davidoff, 2013). Our results indicate a particularly protracted developmental trajectory for the processing of metric part relations. Schoolchildren aged 7 to 14 years and adults were tested in 3-Alternative-Forced-Choice tasks to judge the correct appearance of upright and inverted newly learned multipart objects that had been manipulated in terms of individual parts or part relations. Experiment 1 showed that even the youngest tested children were close to adult levels of performance for recognizing categorical changes of individual parts and relative part position. By contrast, Experiment 2 demonstrated that performance for detecting metric changes of relative part position was distinctly reduced in young children compared with recognizing metric changes of individual parts, and did not approach the latter until 11 to 12 years. A similar developmental dissociation was observed in Experiment 3, which contrasted the detection of metric relative-size changes and metric part changes. Experiment 4 showed that manipulations of metric size that were perceived as part (rather than part-relational) changes eliminated this dissociation. Implications for theories of object recognition and similarities to the development of face perception are discussed. © 2014 American Psychological Association.

Methods of Color Images Procession for Further Identification of the Object

The offered paper deals with the problems of color images preliminary procession. Among these are: interference control (local ones and noise) and extraction of the object from the background on the stage preceding the process of contours extraction. It was considered for a long time that execution of smoothing in segmentation through the boundary extraction is inadmissible, but the described methods and the obtained results evidence about expedience of using the noise control methods.

A stable graph-based representation for object recognition through high-order matching

Many Object recognition techniques perform some flavour of point pattern matching between a model and a scene. Such points are usually selected through a feature detection algorithm that is robust to a class of image transformations and a suitable descriptor is computed over them in order to get a reliable matching. Moreover, some approaches take an additional step by casting the correspondence problem into a matching between graphs defined over feature points. The motivation is that the relational model would add more discriminative power, however the overall effectiveness strongly depends on the ability to build a graph that is stable with respect to both changes in the object appearance and spatial distribution of interest points. In fact, widely used graph-based representations, have shown to suffer some limitations, especially with respect to changes in the Euclidean organization of the feature points. In this paper we introduce a technique to build relational structures over corner points that does not depend on the spatial distribution of the features. © 2012 ICPR Org Committee.

Algorithms for efficient transaction management and consistent queries in client -server semantic object-oriented parallel databases

Large read-only or read-write transactions with a large read set and a small write set constitute an important class of transactions used in such applications as data mining, data warehousing, statistical applications, and report generators. Such transactions are best supported with optimistic concurrency, because locking of large amounts of data for extended periods of time is not an acceptable solution. The abort rate in regular optimistic concurrency algorithms increases exponentially with the size of the transaction. The algorithm proposed in this dissertation solves this problem by using a new transaction scheduling technique that allows a large transaction to commit safely with significantly greater probability that can exceed several orders of magnitude versus regular optimistic concurrency algorithms. A performance simulation study and a formal proof of serializability and external consistency of the proposed algorithm are also presented.^ This dissertation also proposes a new query optimization technique (lazy queries). Lazy Queries is an adaptive query execution scheme which optimizes itself as the query runs. Lazy queries can be used to find an intersection of sub-queries in a very efficient way, which does not require full execution of large sub-queries nor does it require any statistical knowledge about the data.^ An efficient optimistic concurrency control algorithm used in a massively parallel B-tree with variable-length keys is introduced. B-trees with variable-length keys can be effectively used in a variety of database types. In particular, we show how such a B-tree was used in our implementation of a semantic object-oriented DBMS. The concurrency control algorithm uses semantically safe optimistic virtual "locks" that achieve very fine granularity in conflict detection. This algorithm ensures serializability and external consistency by using logical clocks and backward validation of transactional queries. A formal proof of correctness of the proposed algorithm is also presented. ^

Video anomaly detection in real-time on a Power-Aware Heterogeneous Platform

FPGAs and GPUs are often used when real-time performance in video processing is required. An accelerated processor is chosen based on task-specific priorities (power consumption, processing time and detection accuracy), and this decision is normally made once at design time. All three characteristics are important, particularly in battery-powered systems. Here we propose a method for moving selection of processing platform from a single design-time choice to a continuous run time one.We implement Histogram of Oriented Gradients (HOG) detectors for cars and people and Mixture of Gaussians (MoG) motion detectors running across FPGA, GPU and CPU in a heterogeneous system. We use this to detect illegally parked vehicles in urban scenes. Power, time and accuracy information for each detector is characterised. An anomaly measure is assigned to each detected object based on its trajectory and location, when compared to learned contextual movement patterns. This drives processor and implementation selection, so that scenes with high behavioural anomalies are processed with faster but more power hungry implementations, but routine or static time periods are processed with power-optimised, less accurate, slower versions. Real-time performance is evaluated on video datasets including i-LIDS. Compared to power-optimised static selection, automatic dynamic implementation mapping is 10% more accurate but draws 12W extra power in our testbed desktop system.

Code pattern analysis of object-oriented programming languages

Code patterns, including programming patterns and design patterns, are good references for programming language feature improvement and software re-engineering. However, to our knowledge, no existing research has attempted to detect code patterns based on code clone detection technology. In this study, we build upon the previous work and propose to detect and analyze code patterns from a collection of open source projects using NiPAT technology. Because design patterns are most closely associated with object-oriented languages, we choose Java and Python projects to conduct our study. The tool we use for detecting patterns is NiPAT, a pattern detecting tool originally developed for the TXL programming language based on the NiCad clone detector. We extend NiPAT for the Java and Python programming languages. Then, we try to identify all the patterns from the pattern report and classify them into several different categories. In the end of the study, we analyze all the patterns and compare the differences between Java and Python patterns.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.