1000 resultados para Microscopia de tunelamento de eletrons
Resumo:
Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.
Resumo:
Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.
Resumo:
The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.
Resumo:
It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Neuronal ceroid-lipofuscinosis (NCL) is a recent term, proposed for acurate designation of the late-onset types of Amaurotic Family Idiocy (AFI). Histopathology shows ubiquitous intraneuronal accumulation of lipopigments, being the most important factor for characterization of the entity at present time. Biochemical changes and pathogenesis are obscure. NCL is in contrast to the infantile type of AFI (Tay-Sachs disease), in which intraneuronal accumulation of gangliosides (sphingolipids) is due to the well known deficiency of a lysosomal enzyme. The authors report on four cases of NCL, two brothers of the late infantile (Jansky-Bielschowsky) type and a brother and a sister of the juvenile (Spielmeyer-Sjögren) type. One autopsy and three cortical biopsies revealed moderate to severe distention of the neurons by lipopigment, with nerve cell loss, gliosis and cerebral atrophy. Lipopigment was also increased in liver, heart and spleen. The patients were the first in Brazilian literature in whom the storage material was identified as lipopigment by histochemical methods. A brief summary of the clinical features of NCL is presented, and relevant problems are discussed, concerning interpretation of the nature of the storage material, and significance of the disease for gerontological research.
Resumo:
Removable partial dentures (RPD) demand specific hygienic cleaning and the combination of brushing with immersion in chemical solutions has been the most recommended method for control of biofilm. However, the effect of the cleansers on metallic components has not been widely investigated. This study evaluated the effect of different cleansers on the surface of RPD. Five disc specimens (12 mm x 3 mm metallic disc centered in a 38 x 18 x 4 mm mould filled with resin) were obtained for each experimental situation: 6 solutions [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) control] and 2 Co-Cr alloys [DeguDent (DD) and VeraPDI (VPDI)] were used for each experimental situation. A 180-day immersion was simulated and the measurements of roughness (Ra, µm) of metal and resin were analyzed using 2-way ANOVA and Tukey’s test. The surface changes and tarnishes were examined with a scanning electronic microscopy (SEM). In addition, energy dispersive x-ray spectrometry (EDS) analysis was carried out at representative areas. Visually, NaOCl and MI specimens presented surface tarnishes. The roughness of materials was not affected by the solutions (p>0.05). SEM images showed that NaOCl and MI provided surface changes. EDS analysis revealed the presence of oxygen for specimens in contact with both MI and NaOCl solutions, which might suggest that the two solutions promoted the oxidation of the surfaces, thus leading to spot corrosion. Within the limitations of this study, it may be concluded that the NaOCl and MI may not be suitable for cleaning of RPD.
Resumo:
This ex vivo study evaluated dentin permeability of the root canal in the apical third of different human groups of teeth. Eighty teeth were used, 8 from each dental group: maxillary and mandibular central incisors, lateral incisors and canines, maxillary first premolars (buccal and palatal roots), mandibular first premolars, and maxillary and mandibular second premolars, totalizing 88 roots that were distributed in 11 groups. The root canals were instrumented, irrigated with 1% NaOCl and 15% EDTA. Roots were immersed in 10% copper sulfate for 30 min and then in 1% rubeanic acid alcohol solution for the same period; this chemical reaction reveals dentin permeability by the formation of copper rubeanate, which is a dark-colored compound. Semi-serial 100-µm-thick cross-sections were obtained from the apical third of the roots. Five sections of each apical third were washed, dehydrated, cleared and mounted on glass slides for examination under optical microscopy. The percentage of copper ion infiltration and the amount of tubular dentin were quantified by morphometric analysis. The penetration of copper ions in the apical third ranged from 4.60 to 16.66%. The mandibular central and lateral incisors presented the highest dentin permeability (16.66%), while the maxillary canines and mandibular second and first premolars presented the lowest dentin permeability (4.60%, 4.80% and 5.71%, respectively; p<0.001). The other teeth presented intermediate permeability. In conclusion, dye penetration into dentin tubules at the apical region is strongly dependent on the group of teeth evaluated.
Resumo:
This study evaluated in vitro the capacity of debris removal from the apical third of flattened root canals, using different final irrigation protocols. Thirty human mandibular central incisors with a mesiodistal flattened root were prepared using rotary instrumentation by Endo-Flare 25.12 and Hero 642 30.06, 35.02, 40.02 files, irrigated with 2 mL of 1% NaOCl after each file. The specimens were randomly distributed into 5 groups according to the final irrigation of root canals: Group I: 10 mL of distilled water (control), Group II: 10 mL of 1% NaOCl for 8 min, Group III: 2 mL of 1% NaOCl for 2 min (repeated 4 times), Group IV: 10 mL of 2.5% NaOCl for 8 min, and Group V: 10 mL of 2.5% NaOCl for 2 min (repeated 4 times). The apical thirds of the specimens were subjected to histological processing and 6-μm cross-sections were obtained and stained with hematoxylin-eosin. The specimens were examined under optical microscopy at ×40 magnification and the images were subjected to morphometric analysis using the Scion image-analysis software. The total area of root canal and the area with debris were measured in square millimeters. Analysis of variance showed no statistically significant difference (p>0.05) among the groups GI (2.39 ± 3.59), GII (2.91 ± 2.21), GIII (0.73 ± 1.36), GIV (0.95 ± 0.84) and GV (0.51 ± 0.22). In conclusion, the final irrigation protocols evaluated in this study using the Luer syringe presented similar performance in the removal of debris from the apical third of flattened root canals.
Resumo:
This study investigated the influence of cervical preflaring with different rotary instruments on determination of the initial apical file (IAF) in mesiobuccal roots of mandibular molars. Fifty human mandibular molars whose mesial roots presented two clearly separated apical foramens (mesiobuccal and mesiolingual) were used. After standard access opening and removal of pulp tissue, the working length (WL) was determined at 1 mm short of the root apex. Five groups (n=10) were formed at random, according to the type of instrument used for cervical preflaring. In group 1, the size of the IAF was determined without preflaring of the cervical and middle root canal thirds. In groups 2 to 5, preflaring was performed with Gates-Glidden drills, ProTaper instruments, EndoFlare instruments and LA Axxes burs, respectively. Canals were sized manually with K-files, starting with size 08 K-files, inserted passively up to the WL. File sizes were increased until a binding sensation was felt at the WL and the size of the file was recorded. The instrument corresponding to the IAF was fixed into the canal at the WL with methylcyanoacrylate. The teeth were then sectioned transversally 1 mm short of the apex, with the IAF in position. Cross-sections of the WL region were examined under scanning electron microscopy and the discrepancies between canal diameter and the diameter of IAF were calculated using the tool "rule" (FEG) of the microscope's proprietary software. The measurements (µm) were analyzed statistically by Kruskal-Wallis and Dunn's tests at 5% significance level. There were statistically significant differences among the groups (p<0.05). The non-flared group had the greatest discrepancy (125.30 ± 51.54) and differed significantly from all flared groups (p<0.05). Cervical preflaring with LA Axxess burs produced the least discrepancies (55.10 ± 48.31), followed by EndoFlare instruments (68.20 ± 42.44), Gattes Glidden drills (68.90 ± 42.46) and ProTaper files (77.40 ± 73.19). However, no significant differences (p>0.05) were found among the rotary instruments. In conclusion, cervical preflaring improved IAF fitting to the canals at the WL in mesiobuccal roots of maxillary first molars. The rotary instruments evaluated in this study did not differ from each other regarding the discrepancies produced between the IAF size and canal diameter at the WL.
Resumo:
OBJETIVO: avaliar os efeitos da administração da associação zidovudina-lamivudina-ritonavir nos fígados e rins de ratas prenhes e seus conceptos do ponto de vista morfológico e fisiológico. MÉTODOS: 40 ratas albinas prenhes foram aleatoriamente divididas em 4 grupos: 1 controle (Ctrl: controle de veículo) e 3 experimentais (Exp1x, Exp3x e Exp9x). Estes últimos foram tratados por solução oral de zidovudina/lamivudina/ritonavir (Exp1x: 10/5/20 mg/kg; Exp3x: 30/15/60 mg/kg; Exp9x: 90/45/180 mg/kg). As drogas e o veículo foram administrados por gavagem, desde o 1º até o 20º dia de prenhez. No último dia do experimento, todos os animais foram anestesiados e sangue foi retirado da cavidade cardíaca para avaliação sérica das enzimas aspartato aminotransferase (AST) e alanina aminotransferase (ALT), por método calorimétrico, bem como da ureia, determinada por método cinético-enzimático, e creatinina, por método cinético-colorimétrico. Em seguida, fragmentos dos fígados e rins maternos e fetais foram coletados, fixados em formol a 10% e processados segundo os métodos histológicos para inclusão em parafina. Cortes com 5 µm de espessura foram corados pela hematoxilina-eosina (HE) e analisados por microscopia de luz. Na leitura das lâminas, considerou-se o padrão de normalidade para fígado e rins, tais como: hepatócitos, espaço porta íntegros e veias hepáticas bem definidas. Nos rins, a presença de corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Nos fígados fetais considerou-se, ainda, a morfologia das células da linhagem eritrocitária nas diferentes fases do desenvolvimento, bem como os megacariócitos. Quando houve alteração da coloração padrão estabelecida para as estruturas hepáticas e renais, alteração na morfologia de núcleos, rompimento de limites de alguma organela citoplasmática, presença de congestão vascular, tudo isso foi entendido como provavelmente provocado pelas drogas em sua(s) dose(s) de aplicação. A avaliação estatística foi realizada por análise de variância (ANOVA), completada pelo teste de Tukey-Kramer (p<0,05). RESULTADOS: os fígados maternos dos grupos Ctrl, Exp1x e Exp3x mostraram hepatócitos típicos, espaço porta íntegros e veias hepáticas com aspecto normal. No fígado materno do grupo Exp9x, foram encontrados hepatócitos com sinais de atrofia e apoptose (eosinofilia citoplasmática e núcleos picnóticos). Além disso, identificou-se vasodilatação dos capilares sinusoides (congestão). Os rins maternos dos grupos Ctrl e Exp1x apresentaram-se normais, com corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Já nos grupos Exp3x e Exp9x, foram encontrados congestão vascular, glomérulos pequenos ricos em células contendo núcleos hipercromáticos, sendo mais intensos no Exp9x. Com relação aos fígados e rins fetais, não foram observadas alterações morfológicas ou fisiológicas nos grupos estudados. Encontrou-se aumento significante nos níveis da AST (305,70±55,80; p<0,05) e da creatinina (0,50±0,09; p<0,05) no grupo Exp9x. CONCLUSÕES: nossos resultados evidenciam que a administração da associação zidovudina/lamivudina/ritonavir a ratas prenhes em altas doses causa alterações morfológicas e funcionais nos fígados e rins maternos. Não houve alterações nem morfológicas nem fisiológicas nos fígados e rins fetais.
Resumo:
A etiologia da paralisia facial periférica idiopática (PFPI) ainda é uma incógnita, no entanto, alguns autores aventam a possibilidade de ser uma infecção viral. OBJETIVO: Analisar a ultraestrutura do nervo facial procurando evidências virais que possam nos fornecer dados etiológicos. MATERIAL E MÉTODO: Foram estudados 20 pacientes com PFP, com graus de moderado a severo, de ambos os sexos, entre 18-60 anos, provenientes de Ambulatório de Distúrbios do Nervo Facial. Os pacientes foram divididos em dois grupos: Estudo, onze pacientes com PFPI e Controle, nove pacientes com Paralisia Facial Periférica Traumática ou Tumoral. Foram estudados fragmentos de bainha do nervo facial ou fragmentos de seus cotos, que durante a cirurgia de reparação do nervo facial, seriam desprezados ou encaminhados para estudo anatomopatológico. O tecido foi fixado em glutaraldeído 2% e analisado em Microscopia Eletrônica de Transmissão. RESULTADO: Observamos no grupo estudo atividade celular intensa de reparação com aumento de fibras colágenas, fibroblastos com organelas desenvolvidas, isentos de partículas virais. No grupo controle esta atividade de reparação não foi evidente, mas também não foram observadas partículas virais. CONCLUSÃO: Não foram encontradas partículas virais, no entanto, houve evidências de intensa atividade de reparação ou infecção viral.
Resumo:
A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.
Resumo:
Foi feito o estudo anatômico da folha de Eugenia florida DC., espécie arbórea da família Myrtaceae, coletada no Campus da Fundação Oswaldo Cruz, Rio de Janeiro, RJ. A espécie apresenta importantes propriedades farmacológicas, incluindo-se atividade antiviral. O presente estudo teve como objetivo fornecer dados, revelados através da microscopia óptica e da microscopia eletrônica de varredura, que possam contribuir para o conhecimento da espécie e, conseqüentemente, para a segurança em sua identificação. Anatomicamente, a folha é hipostomática, com organização dorsiventral do mesofilo. Apresenta tricomas simples apenas sobre a nervura mediana da face adaxial. As células epidérmicas apresentam contorno sinuoso em vista frontal e cutícula estriada. O parênquima paliçádico destaca-se pela grande quantidade de cristais prismáticos de oxalato de cálcio. Em posição subepidérmica ocorrem cavidades secretoras de óleos essenciais, pouco numerosas, nas duas faces da lâmina foliar. As células epidérmicas situadas sobre as estruturas secretoras constituem característica de valor diagnóstico e são reconhecíveis pela célula de topo, que é reniforme, circundada pelas adjacentes, que apresentam disposição radiada. A comparação entre folhas de sol e de sombra revela que, nas primeiras, as estruturas secretoras são completamente diferenciadas, ao contrário das folhas de sombra, além de apresentarem maior concentração de compostos ergásticos.
Resumo:
Folhas de Myrcia multiflora (Lam.) DC. são usadas na medicina popular como hipoglicemiantes. O objetivo deste trabalho foi caracterizar morfológica e anatomicamente as folhas desta planta, de modo que os dados obtidos possam ser utilizados como referência em exames de controle de qualidade de amostras de fármacos, com vistas a verificar a autenticidade. Folhas inteiras foram diafanizadas e coradas para o estudo da nervação. Secções transversais do pecíolo e transversais e paradérmicas da lâmina foliar foram analisadas em microscópio óptico (MO) e a superfície do limbo foi observada, também, em microscopia eletrônica de varredura (MEV). Foram aplicados testes histoquímicos em material fresco, para identificação e localização de glicídios, amido, taninos, lignina, cristais e sílica. Morfologicamente, a folha é simples, oval-elíptica, com margem inteira, base aguda, ápice acuminado e textura cartácea. A venação é do tipo camptódromo-broquidódromo. Anatomicamente, a folha é hipostomática, com mesofilo compacto e dorsiventral, com três estratos de parênquima paliçádico. A epiderme é uniestratificada, silicificada em algumas regiões e as células exibem paredes anticlinais retas. Em posição subepidérmica ocorrem numerosas cavidades secretoras de óleos essenciais. Os feixes vasculares são colaterais e acompanhados por séries cristalíferas. Os dados obtidos são comparados com os de outras espécies de Myrtaceae e conclui-se que as características morfológicas e anatômicas de M. multiflora contribuem para a diagnose.