Posttranscriptional regulation of sodium-iodide symporter mRNA expression in the rat thyroid gland by acute iodide administration

Serrano-Nascimento C, Calil-Silveira J, Nunes MT. Posttranscriptional regulation of sodium-iodide symporter mRNA expression in the rat thyroid gland by acute iodide administration. Am J Physiol Cell Physiol 298: C893-C899, 2010. First published January 27, 2010; doi:10.1152/ajpcell.00224.2009.-Iodide is an important regulator of thyroid activity. Its excess elicits the Wolff-Chaikoff effect, characterized by an acute suppression of thyroid hormone synthesis, which has been ascribed to serum TSH reduction or TGF-beta increase and production of iodolipids in the thyroid. These alterations take hours/days to occur, contrasting with the promptness of Wolff-Chaikoff effect. We investigated whether acute iodide administration could trigger events that precede those changes, such as reduction of sodium-iodide symporter (NIS) mRNA abundance and adenylation, and if perchlorate treatment could counteract them. Rats subjected or not to methylmercaptoimidazole treatment (0.03%) received NaI (2,000 mu g/0.5 ml saline) or saline intraperitoneally and were killed 30 min up to 24 h later. Another set of animals was treated with iodide and perchlorate, in equimolar doses. NIS mRNA content was evaluated by Northern blotting and real-time PCR, and NIS mRNA poly(A) tail length by rapid amplification of cDNA ends-poly(A) test (RACE-PAT). We observed that NIS mRNA abundance and poly(A) tail length were significantly reduced in all periods of iodide treatment. Perchlorate reversed these effects, indicating that iodide was the agent that triggered the modifications observed. Since the poly(A) tail length of mRNAs is directly associated with their stability and translation efficiency, we can assume that the rapid decay of NIS mRNA abundance observed was due to a reduction of its stability, a condition in which its translation could be impaired. Our data show for the first time that iodide regulates NIS mRNA expression at posttranscriptional level, providing a new mechanism by which iodide exerts its autoregulatory effect on thyroid.

Low-level Laser Therapy Improves Skeletal Muscle Performance, Decreases Skeletal Muscle Damage and Modulates mRNA Expression of COX-1 and COX-2 in a Dose-dependent Manner

We tested if modulation in mRNA expression of cyclooxygenase isoforms (COX-1 and COX-2) can be related to protective effects of phototherapy in skeletal muscle. Thirty male Wistar rats were divided into five groups receiving either one of four laser doses (0.1, 0.3, 1.0 and 3.0 J) or a no-treatment control group. Laser irradiation (904 nm, 15 mW average power) was performed immediately before the first contraction for treated groups. Electrical stimulation was used to induce six tetanic tibial anterior muscle contractions. Immediately after sixth contraction, blood samples were collected to evaluate creatine kinase activity and muscles were dissected and frozen in liquid nitrogen to evaluate mRNA expression of COX-1 and COX-2. The 1.0 and 3.0 J groups showed significant enhancement (P < 0.01) in total work performed in six tetanic contractions compared with control group. All laser groups, except the 3.0 J group, presented significantly lower post-exercise CK activity than control group. Additionally, 1.0 J group showed increased COX-1 and decreased COX-2 mRNA expression compared with control group and 0.1, 0.3 and 3.0 J laser groups (P < 0.01). We conclude that pre-exercise infrared laser irradiation with dose of 1.0 J enhances skeletal muscle performance and decreases post-exercise skeletal muscle damage and inflammation.

Prolonged Physical Training Decreases mRNA Levels of Glucocorticoid Receptor and Inflammatory Genes

Background/Aims: Prolonged physical exercise induces adaptive alterations in the hypothalamic-pituitary axis, increasing cortisol metabolism, and reducing cortisol synthesis and glucocorticoid sensitivity. The mechanisms responsible for this relative glucocorticoid resistance remain unknown but may involve expression of genes encoding glucocorticoid receptor (GR) and/or inflammatory molecules of nuclear factor kappa B1 (NFkB1) signaling pathway and cytokines. This study aimed to determine the impact of prolonged physical training on the expression of genes involved in glucocorticoid action and inflammatory response. Methods: Normal sedentary male cadets of the Brazilian Air Force Academy were submitted to 6 weeks of standardized physical training. Eighteen of 29 initially selected cadets were able to fully complete the training program. Fasting glucose, insulin and cortisol levels, cytokine concentration and the expression of genes encoding GR, NFkB1, inhibitor of NFkB1 and IkB kinase A were determined before and after the training period. Results: Prolonged physical exercise reduced the basal cortisol levels and the percent cortisol reduction after dexamethasone. These findings were associated with a significant reduction in the mRNA levels of GR (6.3%), NFkB1 (63%), inhibitor of NFkB1 (25%) and IkB kinase A (46%) with concomitant reduction in cytokine concentrations (ELISA). Conclusions: Prolonged physical training decreases the glucocorticoid sensitivity and the mRNA levels of the GR gene combined with decreased mRNA of genes related to the NFkB pathway. Copyright (C) 2010 S. Karger AG, Basel

T3 rapidly modulates TSH beta mRNA stability and translational rate in the pituitary of hypothyroid rats

Whereas it is well known that T3 inhibits TSH beta gene transcription, its effects on TSH beta mRNA stability and translation have been poorly investigated. This study examined these possibilities, by evaluating the TSH beta transcripts poly(A) tail length, translational rate and binding to cytoskeleton, in pituitaries of thyroidectomized and sham-operated rats treated with T3 or saline, and killed 30 min thereafter. The hypothyroidism induced an increase of TSH beta transcript poly(A) tail, as well as of its content in ribosomes and attachment to cytoskeleton. The hypothyroid rats acutely treated with T3 exhibited a reduction of TSH beta mRNA poly(A) tail length and recruitment to ribosomes, indicating that this treatment decreased the stability and translation rate of TSH beta mRNA. Nevertheless, acute T3 administration to sham-operated rats provoked an increase of TSH beta transcripts binding to ribosomes. These data add new insight to an important role of T3 in rapidly regulating TSH gene expression at posttranscriptional level. (C) 2010 Elsevier Ireland Ltd. All rights reserved.

The Thyroid Hormone Receptor (TR) beta-Selective Agonist GC-1 Inhibits Proliferation But Induces Differentiation and TR beta mRNA Expression in Mouse and Rat Osteoblast-Like Cells

Previous studies showed anabolic effects of GC-1, a triiodothyronine (T3) analogue that is selective for both binding and activation functions of thyroid hormone receptor (TR) beta 1 over TR alpha 1, on bone tissue in vivo. The aim of this study was to investigate the responsiveness of rat (ROS17/2.8) and mouse (MC3T3-E1) osteoblast-like cells to GC-1. As expected, T3 inhibited cellular proliferation and stimulated mRNA expression of osteocalcin or alkaline phosphatase in both cell lineages. Whereas equimolar doses of T3 and GC-1 equally affected these parameters in ROS17/2.8 cells, the effects of GC-1 were more modest compared to those of T3 in MC3T3-E1 cells. Interestingly, we showed that there is higher expression of TR alpha 1 than TR beta 1 mRNA in rat (similar to 20-90%) and mouse (similar to 90-98%) cell lineages and that this difference is even higher in mouse cells, which highlights the importance of TR alpha 1 to bone physiology and may partially explain the modest effects of GC-1 in comparison with T3 in MC3T3-E1 cells. Nevertheless, we showed that TR beta 1 mRNA expression increases (similar to 2.8- to 4.3-fold) as osteoblastic cells undergo maturation, suggesting a key role of TR beta 1 in mediating T3 effects in the bone forming cells, especially in mature osteoblasts. It is noteworthy that T3 and GC-1 induced TR beta 1 mRNA expression to a similar extent in both cell lineages (similar to 2- to 4-fold), indicating that both ligands may modulate the responsiveness of osteoblasts to T3. Taken together, these data show that TR beta selective T3 analogues have the potential to directly induce the differentiation and activity of osteoblasts.

Lithium reduces Gsk3b mRNA levels: implications for Alzheimer Disease

There is evidence of increased systemic expression of active GSK3B in Alzheimer`s disease patients, which apparently is associated with the formation of senile plaques and neurofibrillary tangles. Due to its central role in the pathogenesis of AD, GSK3B is currently a promising target of the pharmaceutical industry. Whilst trials with specific GSK inhibitors in AD are under way, major attention has been focused on the neuroprotective effects of lithium. Whereas the direct and indirect inhibitory effects of lithium over GSK3 activity have been documented by several groups, its effects over Gsk3 transcription have not yet been addressed. We used quantitative PCR to evaluate the transcriptional regulation of Gsk3a and Gsk3b in lithium-treated primary cultures of rat cortical and hippocampal neurons. We found a significant and dose-dependent reduction in the expression of Gsk3b, which was specific to hippocampal cells. This same effect was further confirmed in vivo by measuring Gsk3 expression in different brain regions and in peripheral leukocytes of adult rats treated with lithium. Our studies show that LiCl can modulate Gsk3b transcription in vitro and in vivo. This observation suggest new regulatory effects of lithium over Gsk3b, contributing to the better understanding of its mechanisms of action, offering a new and complementary explanation for Gsk3b modulation and reinforcing its potential for the inhibition of key pathological pathways in Alzheimer`s disease.

Expressão de mRNA e autofosforilação do receptor de IGF-I (insulin-like growth factor I) em miométrio e mioma humano

Resumo não disponível.

Hepatic mRNA expression and plasma levels of insulin-like growth factor-I (IGF-I) in broiler chickens selected for different growth rates

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Thyroid status, but not insulin status, affects expression of avian uncoupling protein mRNA in chicken

The aim of this study was to investigate the hormonal regulation of the avian homolog of mammalian uncoupling protein (avUCP) by studying the impact of thyroid hormones and insulin on avUCP mRNA expression in chickens (Gallus gallus). For 3 wk, chicks received either a standard diet (control group), or a standard diet supplemented with triiodothyronine (T-3; T3 group) or with the thyroid gland inhibitor methimazole (MMI group). A fourth group received injections of the deiodinase inhibitor iopanoic acid (IOP group). During the 4th wk of age, all animals received two daily injections of either human insulin or saline solution. The results indicate a twofold overexpression of avUCP mRNA in gastrocnemius muscle of T3 birds and a clear downregulation (-74%) in MMI chickens compared with control chickens. Insulin injections had no significant effect on avUCP mRNA expression in chickens. This study describes for the first time induction of avUCP mRNA expression by the thermogenic hormone T3 in chickens and supports a possible involvement of avUCP in avian thermogenesis.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Loss of nuclear poly(A)-binding protein 1 causes defects in myogenesis and mRNA biogenesis

The nuclear poly(A)-binding protein 1 (PABPN1) is a ubiquitously expressed protein that plays a critical role in polyadenylation. Short expansions of the polyalanine tract in the N-terminus of PABPN1 lead to oculopharyngeal muscular dystrophy (OPMD), which is an adult onset disease characterized by eyelid drooping, difficulty in swallowing and weakness in the proximal limb muscles. Although significant data from in vitro biochemical assays define the function of PABPN1 in control of poly(A) tail length, little is known about the role of PABPN1 in mammalian cells. To assess the function of PABPN1 in mammalian cells and specifically in cells affected in OPMD, we examined the effects of PABPN1 depletion using siRNA in primary mouse myoblasts from extraocular, pharyngeal and limb muscles. PABPN1 knockdown significantly decreased cell proliferation and myoblast differentiation during myogenesis in vitro. At the molecular level, PABPN1 depletion in myoblasts led to a shortening of mRNA poly(A) tails, demonstrating the cellular function of PABPN1 in polyadenylation control in a mammalian cell. In addition, PABPN1 depletion caused nuclear accumulation of poly(A) RNA, revealing that PABPN1 is required for proper poly(A) RNA export from the nucleus. Together, these experiments demonstrate that PABPN1 plays an essential role in myoblast proliferation and differentiation, suggesting that it is required for muscle regeneration and maintenance in vivo.

An interaction between two RNA binding proteins, Nab2 and Pub1, links mRNA Processing/Export and mRNA stability

mRNA stability is modulated by elements in the mRNA transcript and their cognate RNA binding proteins. Poly(U) binding protein 1 (Pub1) is a cytoplasmic Saccharomyces cerevisiae mRNA binding protein that stabilizes transcripts containing AU-rich elements (AREs) or stabilizer elements (STEs). In a yeast two-hybrid screen, we identified nuclear poly(A) binding protein 2 (Nab2) as being a Pub1-interacting protein. Nab2 is an essential nucleocytoplasmic shuttling mRNA binding protein that regulates poly(A) tail length and mRNA export. The interaction between Pub1 and Nab2 was confirmed by copurification and in vitro binding assays. The interaction is mediated by the Nab2 zinc finger domain. Analysis of the functional link between these proteins reveals that Nab2, like Pub1, can modulate the stability of specific mRNA transcripts. The half-life of the RPS16B transcript, an ARE-like sequence-containing Pub1 target, is decreased in both nab2-1 and nab2-67 mutants. In contrast, GCN4, an STE-containing Pub1 target, is not affected. Similar results were obtained for other ARE- and STE-containing Pub1 target transcripts. Further analysis reveals that the ARE-like sequence is necessary for Nab2-mediated transcript stabilization. These results suggest that Nab2 functions together with Pub1 to modulate mRNA stability and strengthen a model where nuclear events are coupled to the control of mRNA turnover in the cytoplasm.