Biochemical And Morphological Alterations In The Achilles Tendon Of Mdx Mice.

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

Chronic Continuous Exenatide Infusion Does Not Cause Pancreatic Inflammation And Ductal Hyperplasia In Non-human Primates.

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.

P16(ink) (4a) Expression As A Potential Marker Of Low-grade Cervical Intraepithelial Neoplasia Progression.

To evaluate p16(INK) (4a) immunoexpression in CIN1 lesions looking for differences between cases that progress to CIN2/3 maintain CIN1 diagnosis, or spontaneously regress. Seventy-four CIN1 biopsies were studied. In the follow-up, a second biopsy was performed and 28.7% showed no lesion (regression), 37.9% maintained CIN1, and 33.4% progressed to CIN2/3. Immunostaining for p16(INK) (4a) was performed in the first biopsy and it was considered positive when there was strong and diffuse staining of the basal and parabasal layers. Pearson's chi-square was used to compare the groups (p ≤ 0.05). The age of the patients was similar. There was no significant difference in p16(INK) (4a) immunoexpression in the groups, however, statistical analyses showed a significant association when only the progression and regression groups were compared (p = 0.042). Considering p16(INK) (4a) positivity and the progression to CIN2/3, the sensitivity, specificity, positive, and negative predictive values in our cohort were 45%, 75%, 47%, and 94%, respectively. We emphasize that CIN1 with p16(INK) (4a) staining was associated with lesion progression, but the sensitivity was not high. However, the negative predictive value was more reliable (94%) and p16(INK) (4a) may represent a useful biomarker that can identify CIN1 lesions that need particular attention, complementing morphology.

Rugosidade e pigmentação superficial de materiais ionoméricos

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Efeito de baixas doses de radiação X em feridas suturadas e não suturadas - estudo experimental em ratos

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Effect of ageing and immersion in different beverages on properties of denture lining materials

OBJECTIVES: To evaluate the color stability and hardness of two denture liners obtained by direct and indirect techniques, after thermal cycling and immersion in beverages that can cause staining of teeth. MATERIAL AND METHODS: Seventy disc-shaped specimens (18 x 3 mm) processed by direct (DT) and indirect techniques (IT) were made from Elite soft (n=35) and Kooliner (n=35) denture liners. For each material and technique, 10 specimens were subjected to thermal cycling (3,000 cycles) and 25 specimens were stored in water, coffee, tea, soda and red wine for 36 days. The values of color change, Shore A hardness (Elite soft) and Knoop hardness (Kooliner) were obtained. The data were subjected to ANOVA, Tukey's multiple-comparison test, and Kruskal-Wallis test (P<0.05). RESULTS: The thermal cycling promoted a decrease on hardness of Kooliner regardless of the technique used (Initial: 9.09± 1.61; Thermal cycling: 7.77± 1.47) and promoted an increase in the hardness in the DT for Elite Soft (Initial: 40.63± 1.07; Thermal cycling: 43.53± 1.03); hardness of Kooliner (DT: 8.76± 0.95; IT: 7.70± 1.62) and Elite Soft (DT: 42.75± 1.54; IT=39.30± 2.31) from the DT suffered an increase after the immersion in the beverages. The thermal cycling promoted color change only for Kooliner in the IT. Immersion in the beverages did not promote color change for Elite in both techniques. The control group of the DT of Kooliner showed a significant color change. Wine and coffee produced the greatest color change in the DT only for Elite Soft when compared to the other beverages. CONCLUSION: The three variation factors promoted alteration on hardness and color of the tested denture lining materials.

Influence of surface sealant on the translucency of composite resin: effect of immersion time and immersion media

This study evaluated the effect of surface sealant on the translucency of composite resin immersed in different solutions. The study involved the following materials: Charisma, Fortify and coffee, Coca-Cola®, tea and artificial saliva as solutions. Sixty-four specimens (n = 8) were manufactured and immersed in artificial saliva at 37 ± 1 °C. Samples were immersed in the solutions for three times a day and re-immersed in artificial saliva until the translucency readings. The measurements were carried out at nine times: T1 - 24 hours after specimen preparation, T2 - 24 hours after immersion in the solutions, T3 - 48 hours and T4 to T9 - 7, 14, 21, 30, 60 and 90 days, respectively, after immersion. The translucency values were measured using a JOUAN device. The results were subjected to ANOVA and Tukey's test at 5%. The surface sealant was not able to protect the composite resin against staining, the coffee showed the strongest staining action, followed by tea and regarding immersion time, a significant alteration was noted in the translucency of composite resin after 21 days.

Composite resin color stability: influence of light sources and immersion media

OBJECTIVE: This study evaluated the influence of light sources and immersion media on the color stability of a nanofilled composite resin. MATERIAL AND METHODS: Conventional halogen, high-power-density halogen and high-power-density light-emitting diode (LED) units were used. There were 4 immersion media: coffee, tea, Coke® and artificial saliva. A total of 180 specimens (10 mm x 2 mm) were prepared, immersed in artificial saliva for 24 h at 37±1ºC, and had their initial color measured with a spectrophotometer according to the CIELab system. Then, the specimens were immersed in the 4 media during 60 days. Data from the color change and luminosity were collected and subjected to statistical analysis by the Kruskall-Wallis test (p<0.05). For immersion time, the data were subjected to two-way ANOVA test and Fisher's test (p<0.05). RESULTS: High-power-density LED (ΔE=1.91) promoted similar color stability of the composite resin to that of the tested halogen curing units (Jet Lite 4000 plus - ΔE=2.05; XL 3000 - ΔE=2.28). Coffee (ΔE=8.40; ΔL=-5.21) showed the highest influence on color stability of the studied composite resin. CONCLUSION: There was no significant difference in color stability regardless of the light sources, and coffee was the immersion medium that promoted the highest color changes on the tested composite resin.

Vimentin expression and the influence of Matrigel in cell lines of head and neck squamous cell carcinoma

Vimentin is a cytoeskeletal intermediate filament protein commonly observed in mesenchymal cells; however, it can also be found in malignant epithelial cells. It is demonstrated in several carcinomas, such as those of the cervix, breast and bladder, in which it is widely used as a marker of the epithelial to mesenchymal transition that takes place during embryogenesis and metastasis. Vimentin is associated with tumors that show a high degree of invasiveness, being detected in invasion front cells. Its expression seems to be influenced by the tumor microenvironment. The aim of this study was to evaluate vimentin expression in head and neck squamous cell carcinoma (HNSCC) cell lines, and to investigate the contribution of the microenvironment to its expression. HNSCC cell lines (HN6, HN30 and HN31) and an immortalized nontumorigenic cell line (HaCaT) were submitted to a three-dimensional assay with Matrigel. Cytoplasmatic staining of the HN6 cell line cultured without Matrigel and of the HN30 and HN31 cell lines cultured with Matrigel was demonstrated through immunohistochemistry. Western Blotting revealed a significant decrease in vimentin expression for the HN6 cell line and a significant increase for the HN30 and HN31 cell lines cultured with Matrigel. The results suggest that vimentin can be expressed in HNSCC cells and its presence is influenced by the microenvironment of a tumor.

Histologic grading and nucleolar organizer regions in oral squamous cell carcinomas

OBJECTIVE: The purposes of this study were to histologically assess different types of oral squamous cell carcinoma and the silver-binding nucleolar organizer region (AgNOR) morphology in neoplastic cells, as well as to quantify the number of AgNORs in each type of carcinoma in order to relate AgNOR count and histologic grading. MATERIAL AND METHODS: Twenty-eight cases of oral squamous cell carcinoma were divided into 4 groups, namely well-differentiated, moderately differentiated, poorly differentiated, and undifferentiated. For NOR study, 3-µm-thick sections were stained with 50% aqueous silver nitrate solution. The predominant microscopic pattern of NORs was determined. Quantitative analyses of NORs were obtained of all cells present on each histological field using a 0.025 mm² eyepiece graticule. Different histological fields were analyzed until the total number of NORs was 120 cells for each tumor. Kruskall-Wallis test was applied to compare the groups of sample data at a significance level of p=0.05. RESULTS: The mean number of AgNORs per nucleus was 3.20 for the well-differentiated group, 5.33 for the moderately differentiated one, 8.27 for the poorly differentiated one, and 10.08 for the undifferentiated one. AgNOR count was significantly different (p<0.05) among all of the studied groups. CONCLUSION: AgNOR staining technique seems to be a useful diagnostic tool since differences in AgNOR numeric values can be identified in the different types of oral squamous cell carcinoma. This technique is easy to handle and inexpensive, thus justifying its large use in histopathology.

Alterações do trato digestório de cães da raça Golden Retriever afetados pela distrofia muscular

O modelo experimental canino Golden Retriever portador da Distrofia Muscular (GRMD) é o melhor substituto entre os modelos animais para estudar a Distrofia Muscular de Duchenne. Além da musculatura estriada, a doença pode afetar a musculatura estriada cardíaca e a musculatura lisa, e desta forma, o funcionamento do trato digestório, já que o músculo liso é o elemento primário dos órgãos tubulares. Através de estudo morfológico descritivo, o objetivo deste trabalho foi verificar se a distrofia muscular afeta a arquitetura geral do trato digestório e como se dispõe sua estrutura muscular em animais afetados. Foram realizadas avaliações descritivas macro e microscópicas com colorações de Hematoxilina-Eosina, Tricrômio de Masson e Picrosirius. Entre os resultados apresentados, verificou-se que o esôfago e o fígado dos animais afetados encontraram-se alterados, assim como o estômago não ocupava seu lugar habitual. O músculo diafragma apresentava-se atrofiado e diferenças histológicas foram encontradas na camada muscular do sistema gastrointestinal, em geral. Outras estruturas do tubo digestório de GRMDs apresentaram-se de maneira similar a de um animal normal.

Análise morfológica e fisiológica dos fígados e rins de ratas prenhes e seus fetos tratados pela associação zidovudina, lamivudina e ritonavir durante toda a prenhez

OBJETIVO: avaliar os efeitos da administração da associação zidovudina-lamivudina-ritonavir nos fígados e rins de ratas prenhes e seus conceptos do ponto de vista morfológico e fisiológico. MÉTODOS: 40 ratas albinas prenhes foram aleatoriamente divididas em 4 grupos: 1 controle (Ctrl: controle de veículo) e 3 experimentais (Exp1x, Exp3x e Exp9x). Estes últimos foram tratados por solução oral de zidovudina/lamivudina/ritonavir (Exp1x: 10/5/20 mg/kg; Exp3x: 30/15/60 mg/kg; Exp9x: 90/45/180 mg/kg). As drogas e o veículo foram administrados por gavagem, desde o 1º até o 20º dia de prenhez. No último dia do experimento, todos os animais foram anestesiados e sangue foi retirado da cavidade cardíaca para avaliação sérica das enzimas aspartato aminotransferase (AST) e alanina aminotransferase (ALT), por método calorimétrico, bem como da ureia, determinada por método cinético-enzimático, e creatinina, por método cinético-colorimétrico. Em seguida, fragmentos dos fígados e rins maternos e fetais foram coletados, fixados em formol a 10% e processados segundo os métodos histológicos para inclusão em parafina. Cortes com 5 µm de espessura foram corados pela hematoxilina-eosina (HE) e analisados por microscopia de luz. Na leitura das lâminas, considerou-se o padrão de normalidade para fígado e rins, tais como: hepatócitos, espaço porta íntegros e veias hepáticas bem definidas. Nos rins, a presença de corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Nos fígados fetais considerou-se, ainda, a morfologia das células da linhagem eritrocitária nas diferentes fases do desenvolvimento, bem como os megacariócitos. Quando houve alteração da coloração padrão estabelecida para as estruturas hepáticas e renais, alteração na morfologia de núcleos, rompimento de limites de alguma organela citoplasmática, presença de congestão vascular, tudo isso foi entendido como provavelmente provocado pelas drogas em sua(s) dose(s) de aplicação. A avaliação estatística foi realizada por análise de variância (ANOVA), completada pelo teste de Tukey-Kramer (p<0,05). RESULTADOS: os fígados maternos dos grupos Ctrl, Exp1x e Exp3x mostraram hepatócitos típicos, espaço porta íntegros e veias hepáticas com aspecto normal. No fígado materno do grupo Exp9x, foram encontrados hepatócitos com sinais de atrofia e apoptose (eosinofilia citoplasmática e núcleos picnóticos). Além disso, identificou-se vasodilatação dos capilares sinusoides (congestão). Os rins maternos dos grupos Ctrl e Exp1x apresentaram-se normais, com corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Já nos grupos Exp3x e Exp9x, foram encontrados congestão vascular, glomérulos pequenos ricos em células contendo núcleos hipercromáticos, sendo mais intensos no Exp9x. Com relação aos fígados e rins fetais, não foram observadas alterações morfológicas ou fisiológicas nos grupos estudados. Encontrou-se aumento significante nos níveis da AST (305,70±55,80; p<0,05) e da creatinina (0,50±0,09; p<0,05) no grupo Exp9x. CONCLUSÕES: nossos resultados evidenciam que a administração da associação zidovudina/lamivudina/ritonavir a ratas prenhes em altas doses causa alterações morfológicas e funcionais nos fígados e rins maternos. Não houve alterações nem morfológicas nem fisiológicas nos fígados e rins fetais.

Karyological study of Amphisbaena ridleyi (Squamata, Amphisbaenidae), an endemic species of the Archipelago of Fernando de Noronha, Pernambuco, Brazil

The karyotype of Amphisbaena ridleyi, an endemic species of the archipelago of Fernando de Noronha, in State of Pernambuco, Brazil, is described after conventional staining, Ag-NOR impregnation and fluorescence in situ hybridization (FISH) with a telomeric probe. The diploid number is 46, with nine pairs of macrochromosomes (three metacentrics, four subtelocentrics and two acrocentrics) and 14 pairs of microchromosomes. The Ag-NOR is located in the telomeric region of the long arm of metacentric chromosome 2 and FISH revealed signals only in the telomeric region of all chromosomes. Further cytogenetic data on other amphisbaenians as well as a robust phylogenetic hypothesis of this clade is needed in order to understand the evolutionary changes on amphisbaenian karyotypes.

Astyanax hastatus Myers, 1928 (Teleostei, Characidae): a new species complex within the genus Astyanax?

Four populations of Astyanax hastatus Myers 1928 from the Guapimirim River basin (Rio de Janeiro State) were analyzed and three distinct cytotypes identified. These cytotypes presented 2n = 50 chromosomes, with 4M+8SM+10ST+28A (Cytotype A), 8M+10SM+14ST+18A (Cytotype B), 6M+8SM+4ST+32A (Cytotype C) and scanty heterochromatin, mainly located throughout pericentromeric regions of several chromosomal pairs. No homologies with the As-51 satellite DNA were observed in the three cytotypes, although all of them presented multiple 18S rDNA sites, as detected by both silver nitrate staining and FISH (fluorescent in situ hybridization). The application of the term "species complex" in Astyanax is discussed from a cytotaxonomic viewpoint.