977 resultados para Genetic Complementation Test


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background and purpose: The major drug-metabolizing enzymes for the oxidation of oxycodone are CYP2D6 and CYP3A. A high interindividual variability in the activity of these enzymes because of genetic polymorphisms and/or drug-drug interactions is well established. The possible role of an active metabolite in the pharmacodynamics of oxycodone has been questioned and the importance of CYP3A-mediated effects on the pharmacokinetics and pharmacodynamics of oxycodone has been poorly explored. Experimental approach: We conducted a randomized crossover (five arms) double-blind placebo-controlled study in 10 healthy volunteers genotyped for CYP2D6. Oral oxycodone (0.2 mg·kg−1) was given alone or after inhibition of CYP2D6 (with quinidine) and/or of CYP3A (with ketoconazole). Experimental pain (cold pressor test, electrical stimulation, thermode), pupil size, psychomotor effects and toxicity were assessed. Key results: CYP2D6 activity was correlated with oxycodone experimental pain assessment. CYP2D6 ultra-rapid metabolizers experienced increased pharmacodynamic effects, whereas cold pressor test and pupil size were unchanged in CYP2D6 poor metabolizers, relative to extensive metabolizers. CYP2D6 blockade reduced subjective pain threshold (SPT) for oxycodone by 30% and the response was similar to placebo. CYP3A4 blockade had a major effect on all pharmacodynamic assessments and SPT increased by 15%. Oxymorphone Cmax was correlated with SPT assessment (ρS= 0.7) and the only independent positive predictor of SPT. Side-effects were observed after CYP3A4 blockade and/or in CYP2D6 ultra-rapid metabolizers. Conclusions and implications: The modulation of CYP2D6 and CYP3A activities had clear effects on oxycodone pharmacodynamics and these effects were dependent on CYP2D6 genetic polymorphism.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Malondialdehyde (MDA) is a small reactive molecule which occurs ubiqui¬tous among eukaryotes. Interest in this molecule stems from the fact that it can be highly reactive. In green tissues of plants it is apparently formed pre¬dominantly by reactive oxygen species (ROS)-mediated non-enzymatic oxi¬dation (nLPO) of triunsaturated fatty acids (TFAs). MDA which is formed by nLPO is widely used as a disease marker and is regarded to be a cel-lular toxin. Surprisingly, sites of ROS production like mitochondria and chloroplasts possess membranes which are enriched in nLPO-prone polyun¬saturated fatty acids (PUFAs). In this work we showed that chloroplasts are the major site of MDA production in leaves of adult Arabidopsis thaliana plants, whereas analyses in seedlings revealed accumulation in meristematic tissues like the root tip, lateral roots and the apical meristem region. Char-acterizing the MDA pools in more detail, we could show that MDA in plants was predominantly present in a free, non-reactive enolate form. This might explain why it is tolerated in sites where its protonated form could poten¬tially damage the genome and proteome. Analyzing the biological fate of MDA in leaves using labeled MDA-isotopes. we were able to show that MDA is metabolized and used to assemble lipids. The major end-point metabolite was identified as 18:3-16:3-monqgalactosyldiacylglycerol (MGDG), which is the most abundant lipid in chloroplasts. We hypothesize that PUFAs in sites of ROS production, like at PS II in chloroplasts, might act as buffers pre¬venting damage of proteins, thereby generating molecules such as MDA. The MDA produced in this way appears predominantly in a non-reactive enolate form in the cell until it fulfills a biological function or until it is metabo¬lized in order to assemble polyunsaturated MGDGs. Additionally, nLPO has been reported to increase in pathogenesis and we challenged seedlings and adult plants with necrotrophic fungi. Monitoring MDA during the in¬fections, we found MDA pools in seedlings were highly inducible although they were tightly controlled in the leaves of adult plants. - Malondialdehyde (MDA) est une petite molecule réactive présente de manière ubiquitaire dans les eucaryotes. L'intérêt de cette molécule vient du fait que celle-ci pourrait être très réactive. Dans les tissus verts des plantes, la majorité du MDA est apparement formée par l'oxydation non-enzymatique (nLPO) des acides gras polyinsaturés (PUFAs) transmis par des espèces ac¬tives d'oxygène (ROS). Le MDA formé par nLPO est souvent utilisé comme marqueur de maladies et il est considéré comme une toxine cellulaire. Etonnament, les sites de production comme les mitochondries et les chloro- plastes sont riches en PUFAs qui sont sensibles à la nLPO. Dans cette thèse nous montrons que les chloroplastes répresentent le site de production de MDA dans les feuilles adultes d'Arabidopsis thaliana. Les analyses de MDA dans les plantules ont révélé que le MDA s'accumule dans les tissus meris- tematiques comme celles de la pointe de la racine, des racines latéralles et du meristème apical. Par la caractérisation du MDA présent nous avons pu montrer que la majorité du MDA était présent sous la forme d'un énolate non-réactif. Ceci pourrait expliquer pourquoi le MDA est toléré dans les sites où il pourrait casser le genome ou le protéome s'il est présent sous sa forme protonée. Les analyses du devenir du MDA dans les feuilles par des isotopes du MDA ont montré que celui-ci est metabolisé et utilisé pour assembler des lipides. Le lipide majoritairement métabolisé a été identifié comme étant le 18:3-16:3-monogalactosyldiacylglycerole (MGDG); le lipide le plus abondant dans les chloroplastes. Nous supposons que la présence des PUFAs dans les sites de production du ROS, tout comme le PS II dans les chloroplastes, pourrait jouer un rôle de tampon pour prevenir les protéines de différentes dégradations et ainsi générer des molécules telle que le MDA. La majorité du MDA produit par cette réaction est présente dans la cellule sous la forme d'énolate non-réactif, jusqu'au moment de son utilisation ou lorsqu'il serra metabolisé pour produire des MGDGs polyinsaturés. De plus, il a été décrit que nLPO pourait augmenter dans la pathogenèse, et nous avons testé des plantes adultes et des plantules en présence de champignons nécrotrophiques. L'observation du MDA pendant les infections a montré que les concentrations en MDA sont fortement induites dans les plantules mais contrôlées dans les plantes adultes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The evolution of altruism is a fundamental and enduring puzzle in biology. In a seminal paper Hamilton showed that altruism can be selected for when rb - c > 0, where c is the fitness cost to the altruist, b is the fitness benefit to the beneficiary, and r is their genetic relatedness. While many studies have provided qualitative support for Hamilton's rule, quantitative tests have not yet been possible due to the difficulty of quantifying the costs and benefits of helping acts. Here we use a simulated system of foraging robots to experimentally manipulate the costs and benefits of helping and determine the conditions under which altruism evolves. By conducting experimental evolution over hundreds of generations of selection in populations with different c/b ratios, we show that Hamilton's rule always accurately predicts the minimum relatedness necessary for altruism to evolve. This high accuracy is remarkable given the presence of pleiotropic and epistatic effects as well as mutations with strong effects on behavior and fitness (effects not directly taken into account in Hamilton's original 1964 rule). In addition to providing the first quantitative test of Hamilton's rule in a system with a complex mapping between genotype and phenotype, these experiments demonstrate the wide applicability of kin selection theory.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND AND PURPOSE: The major drug-metabolizing enzymes for the oxidation of oxycodone are CYP2D6 and CYP3A. A high interindividual variability in the activity of these enzymes because of genetic polymorphisms and/or drug-drug interactions is well established. The possible role of an active metabolite in the pharmacodynamics of oxycodone has been questioned and the importance of CYP3A-mediated effects on the pharmacokinetics and pharmacodynamics of oxycodone has been poorly explored. EXPERIMENTAL APPROACH: We conducted a randomized crossover (five arms) double-blind placebo-controlled study in 10 healthy volunteers genotyped for CYP2D6. Oral oxycodone (0.2 mg x kg(-1)) was given alone or after inhibition of CYP2D6 (with quinidine) and/or of CYP3A (with ketoconazole). Experimental pain (cold pressor test, electrical stimulation, thermode), pupil size, psychomotor effects and toxicity were assessed. KEY RESULTS: CYP2D6 activity was correlated with oxycodone experimental pain assessment. CYP2D6 ultra-rapid metabolizers experienced increased pharmacodynamic effects, whereas cold pressor test and pupil size were unchanged in CYP2D6 poor metabolizers, relative to extensive metabolizers. CYP2D6 blockade reduced subjective pain threshold (SPT) for oxycodone by 30% and the response was similar to placebo. CYP3A4 blockade had a major effect on all pharmacodynamic assessments and SPT increased by 15%. Oxymorphone C(max) was correlated with SPT assessment (rho(S)= 0.7) and the only independent positive predictor of SPT. Side-effects were observed after CYP3A4 blockade and/or in CYP2D6 ultra-rapid metabolizers. CONCLUSIONS AND IMPLICATIONS: The modulation of CYP2D6 and CYP3A activities had clear effects on oxycodone pharmacodynamics and these effects were dependent on CYP2D6 genetic polymorphism.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: High-risk sexual behaviors have been suggested as drivers of the recent dramatic increase of sexually transmitted hepatitis C virus (HCV) among human immunodeficiency virus (HIV)-infected men who have sex with men (MSM). METHODS: We assessed the association between the genetic bottleneck of HIV at transmission and the prevalence and incidence of HCV coinfection in HIV-infected MSM from the Swiss HIV Cohort Study (SHCS). As a proxy for the width of the transmission bottleneck, we used the fraction of ambiguous nucleotides detected by genotypic resistance tests sampled during early HIV infection. We defined a broad bottleneck as a fraction of ambiguous nucleotides exceeding a previously established threshold (0.5%). RESULTS: From the SHCS, we identified 671 MSM with available results of HCV serologic tests and with an HIV genotypic resistance test performed during early HIV infection. Of those, 161 (24.0%) exhibited a broad HIV transmission bottleneck, 38 (5.7%) had at least 1 positive HCV test result, and 26 (3.9%) had an incident HCV infection. Individuals with broad HIV transmission bottlenecks exhibited a 2-fold higher odds of having ever experienced an HCV coinfection (odds ratio, 2.2 [95% confidence interval {CI}, 1.1-4.3]) and a 3-fold higher hazard of having an incident HCV infection (hazard ratio, 3.0 [95% CI, 1.4-6.6]) than individuals with narrow HIV transmission bottlenecks. CONCLUSIONS: Our results indicate that the currently occurring sexual spread of HCV is focused on MSM who are prone to exhibit broad HIV transmission bottlenecks. This is consistent with an important role of high-risk behavior and mucosal barrier impairment in the transmission of HCV among MSM.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Geographical barriers may affect the genetic structure of populations by reducing gene exchanges among them. In Switzerland, the common shrew Sorer araneus Linnaeus, 1758 is mostly confined to mountainous areas because of a competing sister species, Millet's shrew S. coronatus Millet, 1828, which occupies most of the Swiss lowlands. The structure of common shrew populations found in different alpine valleys may therefore be affected by the topography. Using microsatellites, genetic structuring of seven shrew populations is investigated among four different valleys of, the Swiss Alps. Using the exact G-test, significant genetic structuring is detected between several valleys. Isolation by distance does not fully explain our results. It appears that high mountain ridges (> 2400 m) can significantly reduce gene flow. F- and R-statistics are estimated and compared to the exact G-tests results. Mantel tests show that F-ST, unlike R-ST, is significantly correlated with differentiation. F-ST remains however low even at high differentiation levels, while R-ST has a high variance. We discuss how these results may have wider implications with regards the interpretation of microsatellite data. Finally, a new microsatellite locus, L99, appears to discriminate S. araneus of the Vaud and Cordon races from both S. araneus Valais and S. coronatus.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objectives of this work were to investigate the genetic structure of the Brazilian hair sheep breeds and to determine the origin of the Santa Inês breed. Molecular similarity was determined using Randomly Amplified Polymorphic DNA - Polymerase Chain Reaction markers in 238 individuals from five naturalized sheep breeds: Santa Inês (48 animals), Rabo Largo (48), Somali (48), Morada Nova (48) and Bergamasca (46), collected in Goiás, Sergipe, Bahia, and Ceará States as well as in the Federal District. Fifty-four loci were selected from 19 primers, after a pilot test using 140 primers. Qualitative analyses indicate diagnostic markers for all breeds. All breeds were significantly different from each other. Interbreed differences were explained by 14.92% of the total variation. Santa Inês clustered with Bergamasca (97% bootstrap) and with Rabo Largo, composing the third member of the group (81% bootstrap) while Morada Nova and Somali breeds clustered separately. Each breed should be considered as a separate management and conservation unit, and special care should be taken with Rabo Largo, Morada Nova and Somali breeds, represented by small herds in Brazil.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this work was to determine genetic and environmental effects on beta-conglycinin and glycinin content in Brazilian soybean cultivars. The concentrations of these protein fractions were analyzed by scanning densitometry after electrophoresis, in 90 Brazilian soybean cultivars sown in Ponta Grossa, PR, in 2001. The effects of the sowing location were determined in the cultivar MG/BR 46 (Conquista), sown in 16 locations of Goiás and Minas Gerais states (Central Brazil), and in the cultivar IAS 5, sown in 12 locations of Paraná and São Paulo states (Southern Brazil), in 2002 soybean season. A significant variability for beta-conglycinin (7S) and glycinin (11S) protein fractions ratio was observed among the 90 Brazilian soybean cultivars. 'MS/BRS 169' (Bacuri) and 'BR-8' (Pelotas) presented the highest and the lowest 11S/7S ratios (2.76 and 1.17, respectively). Beta-conglycinin protein fractions presented more variability than glycinin protein fractions. Grouping test classified 7S proteins in seven groups, 11S proteins in four groups, and protein fraction ratios (11S/7S) in nine groups. Significant effect of sowing locations was also observed on protein fractions contents. There is a good possibility of breeding for individual protein fractions, and their subunits, without affecting protein content.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Glucose levels 2 h after an oral glucose challenge are a clinical measure of glucose tolerance used in the diagnosis of type 2 diabetes. We report a meta-analysis of nine genome-wide association studies (n = 15,234 nondiabetic individuals) and a follow-up of 29 independent loci (n = 6,958-30,620). We identify variants at the GIPR locus associated with 2-h glucose level (rs10423928, beta (s.e.m.) = 0.09 (0.01) mmol/l per A allele, P = 2.0 x 10(-15)). The GIPR A-allele carriers also showed decreased insulin secretion (n = 22,492; insulinogenic index, P = 1.0 x 10(-17); ratio of insulin to glucose area under the curve, P = 1.3 x 10(-16)) and diminished incretin effect (n = 804; P = 4.3 x 10(-4)). We also identified variants at ADCY5 (rs2877716, P = 4.2 x 10(-16)), VPS13C (rs17271305, P = 4.1 x 10(-8)), GCKR (rs1260326, P = 7.1 x 10(-11)) and TCF7L2 (rs7903146, P = 4.2 x 10(-10)) associated with 2-h glucose. Of the three newly implicated loci (GIPR, ADCY5 and VPS13C), only ADCY5 was found to be associated with type 2 diabetes in collaborating studies (n = 35,869 cases, 89,798 controls, OR = 1.12, 95% CI 1.09-1.15, P = 4.8 x 10(-18)).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND AND AIMS: Although it is well known that fire acts as a selective pressure shaping plant phenotypes, there are no quantitative estimates of the heritability of any trait related to plant persistence under recurrent fires, such as serotiny. In this study, the heritability of serotiny in Pinus halepensis is calculated, and an evaluation is made as to whether fire has left a selection signature on the level of serotiny among populations by comparing the genetic divergence of serotiny with the expected divergence of neutral molecular markers (QST-FST comparison). METHODS: A common garden of P. halepensis was used, located in inland Spain and composed of 145 open-pollinated families from 29 provenances covering the entire natural range of P. halepensis in the Iberian Peninsula and Balearic Islands. Narrow-sense heritability (h(2)) and quantitative genetic differentiation among populations for serotiny (QST) were estimated by means of an 'animal model' fitted by Bayesian inference. In order to determine whether genetic differentiation for serotiny is the result of differential natural selection, QST estimates for serotiny were compared with FST estimates obtained from allozyme data. Finally, a test was made of whether levels of serotiny in the different provenances were related to different fire regimes, using summer rainfall as a proxy for fire regime in each provenance. KEY RESULTS: Serotiny showed a significant narrow-sense heritability (h(2)) of 0·20 (credible interval 0·09-0·40). Quantitative genetic differentiation among provenances for serotiny (QST = 0·44) was significantly higher than expected under a neutral process (FST = 0·12), suggesting adaptive differentiation. A significant negative relationship was found between the serotiny level of trees in the common garden and summer rainfall of their provenance sites. CONCLUSIONS: Serotiny is a heritable trait in P. halepensis, and selection acts on it, giving rise to contrasting serotiny levels among populations depending on the fire regime, and supporting the role of fire in generating genetic divergence for adaptive traits.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Context : It is now clearly shown that genetic factors in association with environment play a key role in obesity and eating disorders. This project studies the clinical symptoms and molecular abnormalities in patients carrying a strong hereditary predisposition to obesity and eating behavior disorders. We have previously published the association between the 16:29.5-30.1 deletion and a very penetrant form of morbid obesity and macrocephaly. We have also demonstrated the association between the reciprocal 16:29.5-30.1 duplication and underweight and small head circumference. These 2 studies demonstrate that gene dosage of one or several genes in this region regulates BMI as well as brain growth. At present, there are no data pointing towards particular candidate genes. We are currently investigating a second non-overlapping recurrent CNV encompassing SH2B1, upstream of the aforementioned rearrangement. SNPs in this gene have been associated with BMI in GWAS studies and mice models confirmed this association. Bokuchova et al have reported an association between deletions encompassing this gene and severe early onset obesity, as well as insulin resistance. We are currently collecting and analyzing data to fully characterize the phenotype and the transcriptional patterns associated with this rearrangement. Aims : 1. Identify carriers of any CNVs in the greater 16p11.2 region (between 16:28MB and 32MB) in the EGG consortium. 2. Perform association studies between SNPs in the greater 16p11.2 region (16:28-32MB) and anthropometric measures with adjusted "locus-wide significance", to identify or prioritize candidate genes potentially driving the association observed in patients with the CNVs (and thus worthy of further validation and sequencing). 3. Explore associations between GSV genome-wide and brain volume. 4. Explore relationship between brain volumes (whole brain and regional for those who underwent brain MRI), head circumference and BMI. 5. Extrapolate this procedure to other regions covered by the Metabochip. Methods : - Examine and collect clinical informations, as well as molecular informations in these patients. - Analysis of MRI data in children and adults with BMI > 2SD. Compare changes to MRI data obtained in patients with monogenic forms of obesity (data from Lausanne study) and to underweight (BMI<-2SD) individuals from EGG. - Test whether opposite extremes of the phenotypic distribution may be highly informative Expected results : This is a highly focused study, pertaining to approximately 1 0/00 of the human genome. Yet it is clear that if successful, the lessons learned from this study could be extrapolated to other segments of the genome and would need validation and replication by additional studies. Altogether they will contribute to further explore the missing heritability and point to etiologic genes and pathways underlying these important health burdens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objectives of this work were to investigate the genetic variation in 79 soybean (Glycine max) accessions from different regions of the world, to cluster the accessions based on their similarity, and to test the correlation between the two types of markers used. Simple sequence repeat markers present in genomic (SSR) and in expressed regions (EST-SSR) were used. Thirty SSR primer-pairs were selected (20 genomic and 10 EST-SSR) based on their distribution on the 20 genetic linkage groups of soybean, on their trinucleotide repetition unit and on their polymorphism information content. All analyzed loci were polymorphic, and 259 alleles were found. The number of alleles per locus varied from 2-21, with an average of 8.63. The accessions exhibit a significant number of rare alleles, with genotypes 19, 35, 63 and 65 carrying the greater number of exclusive alleles. Accessions 75 and 79 were the most similar and accessions 31 and 35, and 40 and 78, were the most divergent ones. A low correlation between SSR and EST-SSR data was observed, thus genomic and expressed microsatellite markers are required for an appropriate analysis of genetic diversity in soybean. The genetic diversity observed was high and allowed the formation of five groups and several subgroups. A moderate relationship between genetic divergence and geographic origin of accessions was observed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Différentes organisations et différents pays aboutissent souvent à des conclusions différentes quant à la pertinence d'introduire un test de dépistage génétique dans la population générale. Cet article décrit la complexité du dépistage basé sur des tests génétiques. Utilisant l'exemple de la mucoviscidose - pour laquelle un groupe de travail national est en train d'évaluer la pertinence d'un dépistage génétique - les auteurs relèvent les situaions où les recommandations de dépistage sont parfois basées sur l'émergence de nouvelles technologies (par exemple, test génétique) et d'opinion publique plutôt que sur la base d'évidences. Ils présentent également les enjeux éthiques et économiques du dépistage génétique de la mucoviscidose. [Abstract] Various institutions and countries often reach different conclusions about the utility of introducing a newborn screening test in the general population. This paper highlights the complexity of population screening including genetic tests. Using the example of cystic fibrosis genetic screening, for which a Swiss Working Group for Cystic Fibrosis is currently evaluating the pertinence, we outline that screening recommendations are often based more on expert opinion and emerging new technologies rather than on evidence. We also present some ethical and economic issues related to cystic fibrosis genetic screening.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this work was to compare random regression models for the estimation of genetic parameters for Guzerat milk production, using orthogonal Legendre polynomials. Records (20,524) of test-day milk yield (TDMY) from 2,816 first-lactation Guzerat cows were used. TDMY grouped into 10-monthly classes were analyzed for additive genetic effect and for environmental and residual permanent effects (random effects), whereas the contemporary group, calving age (linear and quadratic effects) and mean lactation curve were analized as fixed effects. Trajectories for the additive genetic and permanent environmental effects were modeled by means of a covariance function employing orthogonal Legendre polynomials ranging from the second to the fifth order. Residual variances were considered in one, four, six, or ten variance classes. The best model had six residual variance classes. The heritability estimates for the TDMY records varied from 0.19 to 0.32. The random regression model that used a second-order Legendre polynomial for the additive genetic effect, and a fifth-order polynomial for the permanent environmental effect is adequate for comparison by the main employed criteria. The model with a second-order Legendre polynomial for the additive genetic effect, and that with a fourth-order for the permanent environmental effect could also be employed in these analyses.