Benjamin.

Mode of access: Internet.

Correspondance d'Orient, 1830-1831,

Mode of access: Internet.

The history of the Old South Church in Boston, in four sermons, delivered May 9, & 16, 1830, being the first and second Sabbaths after the completion of a century from the first occupancy of the present meeting house.

Mode of access: Internet.

Progulki vokrug Tobolʹska v 1830 g.

Mode of access: Internet.

The letters of Algernon Sydney, in defence of civil liberty and against the encroachments of military despotism /

Algernon Sydney identified as Benjamin Watkins Leigh in: Initials and pseudonyms / William Cushing. Waltham, Mass. : Mark Press, 1963.

Description of the picture, Christ healing the sick in the temple, painted by Benjamin West, Esq. ... and presented by the author to the Pennsylvania Hospital.

Attributed to Macquin on title page of his Description of the picture, Christ rejected by the Jews ... (Philadelphia, 1830) and also in the British Museum catalog.

Agende und Union vor dem Richterstuhle der h. Schrift und der Geschichte : mit besonderer Rücksicht auf die seit dem Jahre 1830 in Schlesien entstandenen kirchlichen Bewegungen betrachtet /

Mode of access: Internet.

The life of the late Benjamin Franklin,

Mode of access: Internet.

A sermon preached in St. John's Chapel, New York : on the twenty-sixth day of November, MDCCCXXX, at the consecration Right Reverend Benjamin T. Onderdonk -- /

Mode of access: Internet.

Letters of Benjamin Jowett /

"A supplement to The life and letters of Benjamin Jowett," published in 1897.

Sobre Κρῆτες de Sófocles

En este artículo se estudia una obra atribuida a Sófocles titulada Κρῆτες (Los cretenses), una tragedia sólo conocida por dos dudosos testimonios de Hesiquio y Ateneo de Náucratis. A finales del siglo xviii una nueva lectura de ambos los adscribía a otra tragedia, con lo que se negaba la existencia de Κρῆτες. A pesar de esto, este título se sigue manteniendo en las ediciones de la obra sofoclea, ahora relacionado con nuevos hallazgos de fragmentos papiráceos del autor. Nuestro objetivo es el de analizar los testimonios en profundidad para concluir si la obra pudo o no haberse escrito.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

GLOBAL WELL-POSEDNESS AND NON-LINEAR STABILITY OF PERIODIC TRAVELING WAVES FOR A SCHRODINGER-BENJAMIN-ONO SYSTEM

The objective of this paper is two-fold: firstly, we develop a local and global (in time) well-posedness theory for a system describing the motion of two fluids with different densities under capillary-gravity waves in a deep water flow (namely, a Schrodinger-Benjamin-Ono system) for low-regularity initial data in both periodic and continuous cases; secondly, a family of new periodic traveling waves for the Schrodinger-Benjamin-Ono system is given: by fixing a minimal period we obtain, via the implicit function theorem, a smooth branch of periodic solutions bifurcating a Jacobian elliptic function called dnoidal, and, moreover, we prove that all these periodic traveling waves are nonlinearly stable by perturbations with the same wavelength.