Sensores ópticos com detecção no infravermelho próximo e médio

Optical chemical sensors with detection in the near and mid infrared region are reviewed. Fundamental concepts of infrared spectroscopy and optical chemical sensors are briefly described, before presenting some aspects on optical chemical sensors, such as synthesis of NIR and IR reagents, preparation of new materials as well as application in determinations of species of biological, industrial and environmental importance.

Otimização das condições de extração de saponinas em Ampelozizyphus amazonicus usando planejamento experimental e metodologia de superfície de resposta

This works describes the use of experimental design and surface response methodology for optimization of saponin extraction from Ampelozizyphus amazonicus. For this purpose, a method employing extraction based on maceration assisted by ultrasound technique was utilized. The following factors were studied: extraction length of time and solvent composition. The total saponin was determined by using a gravimetric method and the results expressed by their relative proportion to total crude extract. For the specific condition, 60% hydro-alcoholic solution and 18 minutes extraction length of time has shown the best results. This method can be useful for extraction of substances with biological importance

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para analise cinematica de volumes respiratorios parciais de nadadores

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia de ensino em educação fisica : contribuições de Vygotsky, para as reflexões sobre um modelo pedagogico

Universidade Estadual de Campinas. Faculdade de Educação Física

Metodologia para descrição da orientação do corpo humano

Universidade Estadual de Campinas. Faculdade de Educação Física

Metodologia para analise cinematica da corrida

Universidade Estadual de Campinas. Faculdade de Educação Física

Metodologia para a suavização de dados biomecanicos por função não parametrica ponderada local robusta

Universidade Estadual de Campinas. Faculdade de Educação Física

A ginastica nos cursos de licenciatura em educação fisica do Estado do Parana

Universidade Estadual de Campinas. Faculdade de Educação Física

Proposição de um método de análise de movimentos de jogadores de tênis de campo a partir de vídeos televisivos = : Proposition of a method for tennis players motion analysis on broadcast videos

Universidade Estadual de Campinas . Faculdade de Educação Física

1. Jogos Escolares Brasileiros da Confederação Brasileira de Desportos para Cegos : um estudo de caso

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para descrição tridimensional do movimento humano a partir de cameras de video não sincronizadas

Universidade Estadual de Campinas. Faculdade de Educação Física

Ginastica ritmica : construindo uma metodologia

Universidade Estadual de Campinas . Faculdade de Educação Física

Desenvolvimento de uma metodologia para reconstrução tridimensional e analise de superficies do corpo humano

Universidade Estadual de Campinas . Faculdade de Educação Física