Automatic Bandwidth Estimation Strategy for High-Quality Non-Parametric Modeling based Moving Object Detection

Here, a novel and efficient moving object detection strategy by non-parametric modeling is presented. Whereas the foreground is modeled by combining color and spatial information, the background model is constructed exclusively with color information, thus resulting in a great reduction of the computational and memory requirements. The estimation of the background and foreground covariance matrices, allows us to obtain compact moving regions while the number of false detections is reduced. Additionally, the application of a tracking strategy provides a priori knowledge about the spatial position of the moving objects, which improves the performance of the Bayesian classifier

Improving automatic detection of obstructive sleep apnea through nonlinear analysis of sustained speech

We present a novel approach for the detection of severe obstructive sleep apnea (OSA) based on patients' voices introducing nonlinear measures to describe sustained speech dynamics. Nonlinear features were combined with state-of-the-art speech recognition systems using statistical modeling techniques (Gaussian mixture models, GMMs) over cepstral parameterization (MFCC) for both continuous and sustained speech. Tests were performed on a database including speech records from both severe OSA and control speakers. A 10 % relative reduction in classification error was obtained for sustained speech when combining MFCC-GMM and nonlinear features, and 33 % when fusing nonlinear features with both sustained and continuous MFCC-GMM. Accuracy reached 88.5 % allowing the system to be used in OSA early detection. Tests showed that nonlinear features and MFCCs are lightly correlated on sustained speech, but uncorrelated on continuous speech. Results also suggest the existence of nonlinear effects in OSA patients' voices, which should be found in continuous speech.

Intelligent automatic overtaking system using vision for vehicle detection

There is clear evidence that investment in intelligent transportation system technologies brings major social and economic benefits. Technological advances in the area of automatic systems in particular are becoming vital for the reduction of road deaths. We here describe our approach to automation of one the riskiest autonomous manœuvres involving vehicles – overtaking. The approach is based on a stereo vision system responsible for detecting any preceding vehicle and triggering the autonomous overtaking manœuvre. To this end, a fuzzy-logic based controller was developed to emulate how humans overtake. Its input is information from the vision system and from a positioning-based system consisting of a differential global positioning system (DGPS) and an inertial measurement unit (IMU). Its output is the generation of action on the vehicle’s actuators, i.e., the steering wheel and throttle and brake pedals. The system has been incorporated into a commercial Citroën car and tested on the private driving circuit at the facilities of our research center, CAR, with different preceding vehicles – a motorbike, car, and truck – with encouraging results.

Automatic detection of crop rows in maize fields with high weeds pressure

This paper proposes a new method, oriented to crop row detection in images from maize fields with high weed pressure. The vision system is designed to be installed onboard a mobile agricultural vehicle, i.e. submitted to gyros, vibrations and undesired movements. The images are captured under image perspective, being affected by the above undesired effects. The image processing consists of three main processes: image segmentation, double thresholding, based on the Otsu’s method, and crop row detection. Image segmentation is based on the application of a vegetation index, the double thresholding achieves the separation between weeds and crops and the crop row detection applies least squares linear regression for line adjustment. Crop and weed separation becomes effective and the crop row detection can be favorably compared against the classical approach based on the Hough transform. Both gain effectiveness and accuracy thanks to the double thresholding that makes the main finding of the paper.

Evaluación de la contribución y el impacto de las tecnologías del habla en la detección automática del Síndrome de la Apnea Obstructiva del Sueño = Contributions and impact assessment of speech technologies on the automatic detection of severe Obstructive Sleep Apnea syndrome

La presente Tesis analiza las posibilidades que ofrecen en la actualidad las tecnologías del habla para la detección de patologías clínicas asociadas a la vía aérea superior. El estudio del habla que tradicionalmente cubre tanto la producción como el proceso de transformación del mensaje y las señales involucradas, desde el emisor hasta alcanzar al receptor, ofrece una vía de estudio alternativa para estas patologías. El hecho de que la señal emitida no solo contiene este mensaje, sino también información acerca del locutor, ha motivado el desarrollo de sistemas orientados a la identificación y verificación de la identidad de los locutores. Estos trabajos han recibido recientemente un nuevo impulso, orientándose tanto hacia la caracterización de rasgos que son comunes a varios locutores, como a las diferencias existentes entre grabaciones de un mismo locutor. Los primeros resultan especialmente relevantes para esta Tesis dado que estos rasgos podrían evidenciar la presencia de características relacionadas con una cierta condición común a varios locutores, independiente de su identidad. Tal es el caso que se enfrenta en esta Tesis, donde los rasgos identificados se relacionarían con una de la patología particular y directamente vinculada con el sistema de físico de conformación del habla. El caso del Síndrome de Apneas Hipopneas durante el Sueno (SAHS) resulta paradigmático. Se trata de una patología con una elevada prevalencia mundo, que aumenta con la edad. Los pacientes de esta patología experimentan episodios de cese involuntario de la respiración durante el sueño, que se prolongan durante varios segundos y que se reproducen a lo largo de la noche impidiendo el correcto descanso. En el caso de la apnea obstructiva, estos episodios se deben a la imposibilidad de mantener un camino abierto a través de la vía aérea, de forma que el flujo de aire se ve interrumpido. En la actualidad, el diagnostico de estos pacientes se realiza a través de un estudio polisomnográfico, que se centra en el análisis de los episodios de apnea durante el sueño, requiriendo que el paciente permanezca en el hospital durante una noche. La complejidad y el elevado coste de estos procedimientos, unidos a las crecientes listas de espera, han evidenciado la necesidad de contar con técnicas rápidas de detección, que si bien podrían no obtener tasas tan elevadas, permitirían reorganizar las listas de espera en función del grado de severidad de la patología en cada paciente. Entre otros, los sistemas de diagnostico por imagen, así como la caracterización antropométrica de los pacientes, han evidenciado la existencia de patrones anatómicos que tendrían influencia directa sobre el habla. Los trabajos dedicados al estudio del SAHS en lo relativo a como esta afecta al habla han sido escasos y algunos de ellos incluso contradictorios. Sin embargo, desde finales de la década de 1980 se conoce la existencia de patrones específicos relativos a la articulación, la fonación y la resonancia. Sin embargo, su descripción resultaba difícilmente aprovechable a través de un sistema de reconocimiento automático, pero apuntaba la existencia de un nexo entre voz y SAHS. En los últimos anos las técnicas de procesado automático han permitido el desarrollo de sistemas automáticos que ya son capaces de identificar diferencias significativas en el habla de los pacientes del SAHS, y que los distinguen de los locutores sanos. Por contra, poco se conoce acerca de la conexión entre estos nuevos resultados, los sé que habían obtenido en el pasado y la patogénesis del SAHS. Esta Tesis continua la labor desarrollada en este ámbito considerando específicamente: el estudio de la forma en que el SAHS afecta el habla de los pacientes, la mejora en las tasas de clasificación automática y la combinación de la información obtenida con los predictores utilizados por los especialistas clínicos en sus evaluaciones preliminares. Las dos primeras tareas plantean problemas simbióticos, pero diferentes. Mientras el estudio de la conexión entre el SAHS y el habla requiere de modelos acotados que puedan ser interpretados con facilidad, los sistemas de reconocimiento se sirven de un elevado número de dimensiones para la caracterización y posterior identificación de patrones. Así, la primera tarea debe permitirnos avanzar en la segunda, al igual que la incorporación de los predictores utilizados por los especialistas clínicos. La Tesis aborda el estudio tanto del habla continua como del habla sostenida, con el fin de aprovechar las sinergias y diferencias existentes entre ambas. En el análisis del habla continua se tomo como punto de partida un esquema que ya fue evaluado con anterioridad, y sobre el cual se ha tratado la evaluación y optimización de la representación del habla, así como la caracterización de los patrones específicos asociados al SAHS. Ello ha evidenciado la conexión entre el SAHS y los elementos fundamentales de la señal de voz: los formantes. Los resultados obtenidos demuestran que el éxito de estos sistemas se debe, fundamentalmente, a la capacidad de estas representaciones para describir dichas componentes, obviando las dimensiones ruidosas o con poca capacidad discriminativa. El esquema resultante ofrece una tasa de error por debajo del 18%, sirviéndose de clasificadores notablemente menos complejos que los descritos en el estado del arte y de una única grabación de voz de corta duración. En relación a la conexión entre el SAHS y los patrones observados, fue necesario considerar las diferencias inter- e intra-grupo, centrándonos en la articulación característica del locutor, sustituyendo los complejos modelos de clasificación por el estudio de los promedios espectrales. El resultado apunta con claridad hacia ciertas regiones del eje de frecuencias, sugiriendo la existencia de un estrechamiento sistemático en la sección del tracto en la región de la orofaringe, ya prevista en la patogénesis de este síndrome. En cuanto al habla sostenida, se han reproducido los estudios realizados sobre el habla continua en grabaciones de la vocal /a/ sostenida. Los resultados son cualitativamente análogos a los anteriores, si bien en este caso las tasas de clasificación resultan ser más bajas. Con el objetivo de identificar el sentido de este resultado se reprodujo el estudio de los promedios espectrales y de la variabilidad inter e intra-grupo. Ambos estudios mostraron importantes diferencias con los anteriores que podrían explicar estos resultados. Sin embargo, el habla sostenida ofrece otras oportunidades al establecer un entorno controlado para el estudio de la fonación, que también había sido identificada como una fuente de información para la detección del SAHS. De su estudio se pudo observar que, en el conjunto de datos disponibles, no existen variaciones que pudieran asociarse fácilmente con la fonación. Únicamente aquellas dimensiones que describen la distribución de energía a lo largo del eje de frecuencia evidenciaron diferencias significativas, apuntando, una vez más, en la dirección de las resonancias espectrales. Analizados los resultados anteriores, la Tesis afronta la fusión de ambas fuentes de información en un único sistema de clasificación. Con ello es posible mejorar las tasas de clasificación, bajo la hipótesis de que la información presente en el habla continua y el habla sostenida es fundamentalmente distinta. Esta tarea se realizo a través de un sencillo esquema de fusión que obtuvo un 88.6% de aciertos en clasificación (tasa de error del 11.4%), lo que representa una mejora significativa respecto al estado del arte. Finalmente, la combinación de este clasificador con los predictores utilizados por los especialistas clínicos ofreció una tasa del 91.3% (tasa de error de 8.7%), que se encuentra dentro del margen ofrecido por esquemas más costosos e intrusivos, y que a diferencia del propuesto, no pueden ser utilizados en la evaluación previa de los pacientes. Con todo, la Tesis ofrece una visión clara sobre la relación entre el SAHS y el habla, evidenciando el grado de madurez alcanzado por la tecnología del habla en la caracterización y detección del SAHS, poniendo de manifiesto que su uso para la evaluación de los pacientes ya sería posible, y dejando la puerta abierta a futuras investigaciones que continúen el trabajo aquí iniciado. ABSTRACT This Thesis explores the potential of speech technologies for the detection of clinical disorders connected to the upper airway. The study of speech traditionally covers both the production process and post processing of the signals involved, from the speaker up to the listener, offering an alternative path to study these pathologies. The fact that utterances embed not just the encoded message but also information about the speaker, has motivated the development of automatic systems oriented to the identification and verificaton the speaker’s identity. These have recently been boosted and reoriented either towards the characterization of traits that are common to several speakers, or to the differences between records of the same speaker collected under different conditions. The first are particularly relevant to this Thesis as these patterns could reveal the presence of features that are related to a common condition shared among different speakers, regardless of their identity. Such is the case faced in this Thesis, where the traits identified would relate to a particular pathology, directly connected to the speech production system. The Obstructive Sleep Apnea syndrome (OSA) is a paradigmatic case for analysis. It is a disorder with high prevalence among adults and affecting a larger number of them as they grow older. Patients suffering from this disorder experience episodes of involuntary cessation of breath during sleep that may last a few seconds and reproduce throughout the night, preventing proper rest. In the case of obstructive apnea, these episodes are related to the collapse of the pharynx, which interrupts the air flow. Currently, OSA diagnosis is done through a polysomnographic study, which focuses on the analysis of apnea episodes during sleep, requiring the patient to stay at the hospital for the whole night. The complexity and high cost of the procedures involved, combined with the waiting lists, have evidenced the need for screening techniques, which perhaps would not achieve outstanding performance rates but would allow clinicians to reorganize these lists ranking patients according to the severity of their condition. Among others, imaging diagnosis and anthropometric characterization of patients have evidenced the existence of anatomical patterns related to OSA that have direct influence on speech. Contributions devoted to the study of how this disorder affects scpeech are scarce and somehow contradictory. However, since the late 1980s the existence of specific patterns related to articulation, phonation and resonance is known. By that time these descriptions were virtually useless when coming to the development of an automatic system, but pointed out the existence of a link between speech and OSA. In recent years automatic processing techniques have evolved and are now able to identify significant differences in the speech of OSAS patients when compared to records from healthy subjects. Nevertheless, little is known about the connection between these new results with those published in the past and the pathogenesis of the OSA syndrome. This Thesis is aimed to progress beyond the previous research done in this area by addressing: the study of how OSA affects patients’ speech, the enhancement of automatic OSA classification based on speech analysis, and its integration with the information embedded in the predictors generally used by clinicians in preliminary patients’ examination. The first two tasks, though may appear symbiotic at first, are quite different. While studying the connection between speech and OSA requires simple narrow models that can be easily interpreted, classification requires larger models including a large number dimensions for the characterization and posterior identification of the observed patterns. Anyhow, it is clear that any progress made in the first task should allow us to improve our performance on the second one, and that the incorporation of the predictors used by clinicians shall contribute in this same direction. The Thesis considers both continuous and sustained speech analysis, to exploit the synergies and differences between them. On continuous speech analysis, a conventional speech processing scheme, designed and evaluated before this Thesis, was taken as a baseline. Over this initial system several alternative representations of the speech information were proposed, optimized and tested to select those more suitable for the characterization of OSA-specific patterns. Evidences were found on the existence of a connection between OSA and the fundamental constituents of the speech: the formants. Experimental results proved that the success of the proposed solution is well explained by the ability of speech representations to describe these specific OSA-related components, ignoring the noisy ones as well those presenting low discrimination capabilities. The resulting scheme obtained a 18% error rate, on a classification scheme significantly less complex than those described in the literature and operating on a single speech record. Regarding the connection between OSA and the observed patterns, it was necessary to consider inter-and intra-group differences for this analysis, and to focus on the articulation, replacing the complex classification models by the long-term average spectra. Results clearly point to certain regions on the frequency axis, suggesting the existence of a systematic narrowing in the vocal tract section at the oropharynx. This was already described in the pathogenesis of this syndrome. Regarding sustained speech, similar experiments as those conducted on continuous speech were reproduced on sustained phonations of vowel / a /. Results were qualitatively similar to the previous ones, though in this case perfomance rates were found to be noticeably lower. Trying to derive further knowledge from this result, experiments on the long-term average spectra and intraand inter-group variability ratios were also reproduced on sustained speech records. Results on both experiments showed significant differences from the previous ones obtained from continuous speech which could explain the differences observed on peformance. However, sustained speech also provided the opportunity to study phonation within the controlled framework it provides. This was also identified in the literature as a source of information for the detection of OSA. In this study it was found that, for the available dataset, no sistematic differences related to phonation could be found between the two groups of speakers. Only those dimensions which relate energy distribution along the frequency axis provided significant differences, pointing once again towards the direction of resonant components. Once classification schemes on both continuous and sustained speech were developed, the Thesis addressed their combination into a single classification system. Under the assumption that the information in continuous and sustained speech is fundamentally different, it should be possible to successfully merge the two of them. This was tested through a simple fusion scheme which obtained a 88.6% correct classification (11.4% error rate), which represents a significant improvement over the state of the art. Finally, the combination of this classifier with the variables used by clinicians obtained a 91.3% accuracy (8.7% error rate). This is within the range of alternative, but costly and intrusive schemes, which unlike the one proposed can not be used in the preliminary assessment of patients’ condition. In the end, this Thesis has shed new light on the underlying connection between OSA and speech, and evidenced the degree of maturity reached by speech technology on OSA characterization and detection, leaving the door open for future research which shall continue in the multiple directions that have been pointed out and left as future work.

Neuroanatomic-based detection algorithm for automatic labeling of brain structures in brain injury

The number and grade of injured neuroanatomic structures and the type of injury determine the degree of impairment after a brain injury event and the recovery options of the patient. However, the body of knowledge and clinical intervention guides are basically focused on functional disorder and they still do not take into account the location of injuries. The prognostic value of location information is not known in detail either. This paper proposes a feature-based detection algorithm, named Neuroanatomic-Based Detection Algorithm (NBDA), based on SURF (Speeded Up Robust Feature) to label anatomical brain structures on cortical and sub-cortical areas. Themain goal is to register injured neuroanatomic structures to generate a database containing patient?s structural impairment profile. This kind of information permits to establish a relation with functional disorders and the prognostic evolution during neurorehabilitation procedures.

GMM-based classifiers for the automatic detection of obstructive sleep apnea

The aim of automatic pathological voice detection systems is to serve as tools, to medical specialists, for a more objective, less invasive and improved diagnosis of diseases. In this respect, the gold standard for those system include the usage of a optimized representation of the spectral envelope, either based on cepstral coefficients from the mel-scaled Fourier spectral envelope (Mel-Frequency Cepstral Coefficients) or from an all-pole estimation (Linear Prediction Coding Cepstral Coefficients) forcharacterization, and Gaussian Mixture Models for posterior classification. However, the study of recently proposed GMM-based classifiers as well as Nuisance mitigation techniques, such as those employed in speaker recognition, has not been widely considered inpathology detection labours. The present work aims at testing whether or not the employment of such speaker recognition tools might contribute to improve system performance in pathology detection systems, specifically in the automatic detection of Obstructive Sleep Apnea. The testing procedure employs an Obstructive Sleep Apnea database, in conjunction with GMM-based classifiers looking for a better performance. The results show that an improved performance might be obtained by using such approach.

Automatic expert system based on images for accuracy crop row detection in maize fields

This paper proposes an automatic expert system for accuracy crop row detection in maize fields based on images acquired from a vision system. Different applications in maize, particularly those based on site specific treatments, require the identification of the crop rows. The vision system is designed with a defined geometry and installed onboard a mobile agricultural vehicle, i.e. submitted to vibrations, gyros or uncontrolled movements. Crop rows can be estimated by applying geometrical parameters under image perspective projection. Because of the above undesired effects, most often, the estimation results inaccurate as compared to the real crop rows. The proposed expert system exploits the human knowledge which is mapped into two modules based on image processing techniques. The first one is intended for separating green plants (crops and weeds) from the rest (soil, stones and others). The second one is based on the system geometry where the expected crop lines are mapped onto the image and then a correction is applied through the well-tested and robust Theil–Sen estimator in order to adjust them to the real ones. Its performance is favorably compared against the classical Pearson product–moment correlation coefficient.

Automatic detection of freeway incidents during low volume conditions. Interim report.

Texas State Department of Highways and Public Transportation, Transportation Planning Division, Austin

Automatic detection and treatment of oscillatory and/or stiff ordinary differential equations /

"Presented at the Differential Equation Workshop, Center for Interdisciplinary Research (Zif), University of Bielefeld, West Germany, April 21, 1980."

Feature LDA:a supervised topic model for automatic detection of web API documentations from the web

Web APIs have gained increasing popularity in recent Web service technology development owing to its simplicity of technology stack and the proliferation of mashups. However, efficiently discovering Web APIs and the relevant documentations on the Web is still a challenging task even with the best resources available on the Web. In this paper we cast the problem of detecting the Web API documentations as a text classification problem of classifying a given Web page as Web API associated or not. We propose a supervised generative topic model called feature latent Dirichlet allocation (feaLDA) which offers a generic probabilistic framework for automatic detection of Web APIs. feaLDA not only captures the correspondence between data and the associated class labels, but also provides a mechanism for incorporating side information such as labelled features automatically learned from data that can effectively help improving classification performance. Extensive experiments on our Web APIs documentation dataset shows that the feaLDA model outperforms three strong supervised baselines including naive Bayes, support vector machines, and the maximum entropy model, by over 3% in classification accuracy. In addition, feaLDA also gives superior performance when compared against other existing supervised topic models.

A framework for automatic feature extraction from airborne light detection and ranging data

Recent advances in airborne Light Detection and Ranging (LIDAR) technology allow rapid and inexpensive measurements of topography over large areas. Airborne LIDAR systems usually return a 3-dimensional cloud of point measurements from reflective objects scanned by the laser beneath the flight path. This technology is becoming a primary method for extracting information of different kinds of geometrical objects, such as high-resolution digital terrain models (DTMs), buildings and trees, etc. In the past decade, LIDAR gets more and more interest from researchers in the field of remote sensing and GIS. Compared to the traditional data sources, such as aerial photography and satellite images, LIDAR measurements are not influenced by sun shadow and relief displacement. However, voluminous data pose a new challenge for automated extraction the geometrical information from LIDAR measurements because many raster image processing techniques cannot be directly applied to irregularly spaced LIDAR points. ^ In this dissertation, a framework is proposed to filter out information about different kinds of geometrical objects, such as terrain and buildings from LIDAR automatically. They are essential to numerous applications such as flood modeling, landslide prediction and hurricane animation. The framework consists of several intuitive algorithms. Firstly, a progressive morphological filter was developed to detect non-ground LIDAR measurements. By gradually increasing the window size and elevation difference threshold of the filter, the measurements of vehicles, vegetation, and buildings are removed, while ground data are preserved. Then, building measurements are identified from no-ground measurements using a region growing algorithm based on the plane-fitting technique. Raw footprints for segmented building measurements are derived by connecting boundary points and are further simplified and adjusted by several proposed operations to remove noise, which is caused by irregularly spaced LIDAR measurements. To reconstruct 3D building models, the raw 2D topology of each building is first extracted and then further adjusted. Since the adjusting operations for simple building models do not work well on 2D topology, 2D snake algorithm is proposed to adjust 2D topology. The 2D snake algorithm consists of newly defined energy functions for topology adjusting and a linear algorithm to find the minimal energy value of 2D snake problems. Data sets from urbanized areas including large institutional, commercial, and small residential buildings were employed to test the proposed framework. The results demonstrated that the proposed framework achieves a very good performance. ^

Automatic detection of the inferior alveolar nerve in CT scans with CenterNet

The inferior alveolar nerve (IAN) lies within the mandibular canal, named inferior alveolar canal in literature. The detection of this nerve is important during maxillofacial surgeries or for creating dental implants. The poor quality of cone-beam computed tomography (CBCT) and computed tomography (CT) scans and/or bone gaps within the mandible increase the difficulty of this task, posing a challenge to human experts who are going to manually detect it and resulting in a time-consuming task.Therefore this thesis investigates two methods to automatically detect the IAN: a non-data driven technique and a deep-learning method. The latter tracks the IAN position at each frame leveraging detections obtained with the deep neural network CenterNet, fined-tuned for our task, and temporal and spatial information.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Evidence for divided automatic attention

A long-standing debate in the literature is whether attention can form two or more independent spatial foci in addition to the well-known unique spatial focus. There is evidence that voluntary visual attention divides in space. The possibility that this also occurs for automatic visual attention was investigated here. Thirty-six female volunteers were tested. In each trial, a prime stimulus was presented in the left or right visual hemifield. This stimulus was characterized by the blinking of a superior, middle or inferior ring, the blinking of all these rings, or the blinking of the superior and inferior rings. A target stimulus to which the volunteer should respond with the same side hand or a target stimulus to which she should not respond was presented 100 ms later in a primed location, a location between two primed locations or a location in the contralateral hemifield. Reaction time to the positive target stimulus in a primed location was consistently shorter than reaction time in the horizontally corresponding contralateral location. This attentional effect was significantly smaller or absent when the positive target stimulus appeared in the middle location after the double prime stimulus. These results suggest that automatic visual attention can focus on two separate locations simultaneously, to some extent sparing the region in between.