Aikaerotteisesti fluoresenssia mittaavan reaaliaikaisen PCR-laitteen kehitys

Kvantitatiivinen reaaliaikainen polymeraasiketjureaktio (engl. polymerase chain reaction, PCR) on osoittautunut käyttäjäystävällisimmäksi menetelmäksi nukleiinihapposekvenssien kvantitoimisessa. Tätä menetelmää voidaan herkistää pienempien DNA-pitoisuuksien havaitsemiseen käyttämällä hyväksi aikaerotteista fluorometriaa (engl. time-resolved fluorometry, TRF) ja luminoivia lantanidileimoja, joiden fluoresenssin pitkän eliniän ansiosta emission mittaus voidaan suorittaa vasta hetki virittävän valopulssin jälkeen, jolloin lyhytikäinen taustasäteily ehtii sammua. Tuloksena saadaan korkea signaali-taustasuhde. Tämän diplomityön tarkoituksena oli rakentaa TRF:än pystyvä reaaliaikainen PCR-laite, sillä tällaista laitetta ei ole markkinoilla tarjolla. Laite rakennettiin kehittämällä lämpökierrätin ja yhdistämällä se valmiiseen TRF:än kykenevään mittapäähän. Mittapään ja lämpökierrättimen hallitsemiseksi kehitettiin myös tietokoneohjelma. Valon tuottamiseksi ja mittaamiseksi haluttiin käyttää edullisia komponentteja, joten työssä käytettiin valmiin mittapään optiikkaa, jossa viritys tapahtuu hohtodiodilla (engl. light-emitting diode, LED) ja lantanidileiman emission mittaus fotodiodilla (engl. photodiode, PD) tai valomonistinputkella (engl. photomultiplier tube, PMT). Myös mittapään suorituskykyä tutkittiin. Työtä varten kehitettiin lämpökierrätin, joka koostui Peltier-elementillä lämmitettävästä PCR-putkitelineestä ja lämpökannesta. Mittalaitteen suorituskyvyn tutkimiseen käytettiin kelaattikomplementaatioon perustuvaa PCR-tuotteen havaitsemismenetelmää. Kelaattikomplementaatio perustuu kahteen erilliseen oligonukleotidimolekyyliin, joista toiseen on sidottu lantanidi-ioni ja toiseen valoa absorboiva ligandirakenne, jotka yhdessä muodostavat fluoresoivan kokonaisuuden. Kehitetyn lämpökierrättimen todettiin olevan tarpeeksi tarkka sekä tehokas ja sen lämmitys- ja jäähdytysnopeuden maksimeiksi saatiin 2,6 °C/sekunti. Detektorina käytetyn PD:n ei todettu olevan tarpeeksi herkkä emission havainnoimiseksi ja se korvattiin laitteessa PMT:llä. Käytetyllä PCR-määrityksellä kynnyssykleiksi (engl. threshold cycle, Ct) sekä kehitetylle että referenssilaitteelle saatiin 28,4 käyttämällä samaa 100 000 kopion DNA:n aloitusmäärää. Työssä osoitettiin, että on mahdollista kehittää edullisia komponentteja käyttävä, TRF:än pystyvä, reaaliaikainen PCR-laite, joka kykenee vastaavaan Ct-arvoon kuin vertailulaite. PD:n herkkyys ei kuitenkaan riittänyt. Tulokset olivat lupaavia, sillä LED- ja PD-teknologiat kehittyvät ja markkinoille on tullut myös muita komponentteja, joiden avulla on tulevaisuudessa mahdollista kehittää vielä herkempi laite.

Detection and enumeration of sulphate-reducing bacteria in estuarine sediments by competitive PCR

The distribution of sulphate-reducing bacteria (SRB) in the sediments of the Colne River estuary, Essex, UK covering different saline concentrations of sediment porewater was investigated by the use of quantitative competitive PCR. Here, we show that a new PCR primer set and a new quantitative method using PCR are useful tools for the detection and the enumeration of SRB in natural environments. A PCR primer set selective for the dissimilatory sulphite reductase gene (dsr) of SRB was designed. PCR amplification using the single set of dsr-specific primers resulted in PCR products of the expected size from all 27 SRB strains tested, including Gram-negative and positive species. Sixty clones derived from sediment DNA using the primers were sequenced and all were closely related with the predicted dsr of SRB. These results indicate that PCR using the newly designed primer set are useful for the selective detection of SRB from a natural sample. This primer set was used to estimate cell numbers by dsr selective competitive PCR using a competitor, which was about 20% shorter than the targeted region of dsr. This procedure was applied to sediment samples from the River Colne estuary, Essex, UK together with simultaneous measurement of in situ rates of sulphate reduction. High densities of SRB ranging from 0.2 - 5.7 × 108 cells ml-1 wet sediment were estimated by the competitive PCR assuming that all SRB have a single copy of dsr. Using these estimates cell specific sulphate reduction rates of 10-17 to 10-15 mol of SO42- cell-1 day-1 were calculated, which is within the range of, or lower than, those previously reported for pure cultures of SRB. Our results show that the newly developed competitive PCR technique targeted to dsr is a powerful tool for rapid and reproducible estimation of SRB numbers in situ and is superior to the use of culture-dependent techniques.

Diversity and quantitative analysis of Archaea in aggressive periodontitis and periodontally healthy subjects

P>Aim To investigate the diversity, levels and proportions of Archaea in the subgingival biofilm of generalized aggressive periodontitis (GAgP; n=30) and periodontally healthy (PH; n=30) subjects. Materials and methods Diversity was determined by sequencing archaeal 16S rRNA gene libraries from 20 samples (10/group). The levels and proportions of Archaea were analysed by quantitative PCR (qPCR) in four and two samples/subject in GAgP and PH groups, respectively. Results Archaea were detected in 27/28 subjects and 68% of the sites of the GAgP group, and in 26/30 subjects and 58.3% sites of the PH group. Methanobrevibacter oralis was found in all 20 samples studied, Methanobacterium curvum/congolense in three GAgP and six PH samples, and Methanosarcina mazeii in four samples from each group. The levels and proportions of Archaea were higher in GAgP than in PH, whereas no differences were observed between the two probing depth category sites from the GAgP group. Conclusion Archaea were frequently found in subjects with periodontal health and GAgP, especially M. oralis. However, the higher levels and proportions (Archaea/total prokaryotes) of this domain observed in GAgP in comparison with PH subjects indicate a possible role of some of these microorganisms as an environmental modifier in GAgP.

Quantitative Detection of Enterotoxigenic Bacteroides fragilis Subtypes Isolated from Children with and without Diarrhea

A rapid real-time PCR ( RT-PCR) approach was developed to detect the bft gene subtypes in Bacteroides fragilis isolated from fecal samples. DNA obtained from diarrhea (110) and nondiarrhea (150) samples was evaluated. Subtype 1 was observed in 9 (8.2%) diarrhea and 7 (4.7%) nondiarrhea samples. Subtype 2 was not detected in any DNA samples, and subtype 3 was observed in only 1 diarrhea sample. The presence of the bft-1 gene did not show any statistically significant differences between the groups of children. This technique could be used to evaluate a possible correlation between disease and the presence of B. fragilis enterotoxin.

Quantitative detection of periodontopathic bacteria in atherosclerotic plaques from coronary arteries

Oral pathogens, including periodontopathic bacteria, are thought to be aetiological factors in the development of cardiovascular disease. In this study, the presence of Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum-periodonticum-simiae group, Porphyromonas gingivalis, Prevotella intermedia, Prevotella nigrescens and Tannerella forsythia in atheromatous plaques from coronary arteries was determined by real-time PCR. Forty-four patients displaying cardiovascular disease were submitted to periodontal examination and endarterectomy of coronary arteries. Approximately 60-100 mg atherosclerotic tissue was removed surgically and DNA was obtained. Quantitative detection of periodontopathic bacteria was performed using universal and species-specific TaqMan probe/primer sets. Total bacterial and periodontopathic bacterial DNA were found in 94.9 and 92.3 %, respectively, of the atheromatous plaques from periodontitis patients, and in 80.0 and 20.0%, respectively, of atherosclerotic tissues from periodontally healthy subjects. All periodontal bacteria except for the F. nucleatum-periodonticum-simiae group were detected, and their DNA represented 47.3 % of the total bacterial DNA obtained from periodontitis; patients. Porphyromonas gingivalis, A. actinomycetemcomitans and Prevotella intermedia were detected most often. The presence of two or more periodontal species could be observed in 64.1 % of the samples. In addition, even in samples in which a single periodontal species was detected, additional unidentified microbial DNA could be observed. The significant number of periodontopathic bacterial DNA species in atherosclerotic tissue samples from patients with periodontitis suggests that the presence of these micro-organisms in coronary lesions is not coincidental and that they may in fact contribute to the development of vascular diseases.

Quantitative Analysis of Diepoxybutane Damage within the Chicken β-globin Domain

In industrial polymer and synthetic rubber production facilities, workers are exposed to 1,3-butadiene. This compound is converted in vivo to 1,2,3,4-diepoxybutane (DEB) and has been linked to increased incidences of cancer in these individuals. Carcinogenesis has been attributed to formation of DEB induced DNA interstrand cross-links. Previous studies have demonstrated that DEB cross-links deoxyguanosine residues within 5'-GNC sequences in synthetic DNA, in restriction fragments, and in defined sequence nucleosomes. The current study utilized the polymerase chain reaction (PCR) to examine DEB damage frequencies within nuclear genes, found within "open" regions of chromatin, as compared to regions of unexpressed sequence that reside in tightly packed, "closed" chromatin, to more closely model DEB reactivity in vivo. These initial studies have been performed in chicken liver homogenates. Preliminarily, we have found a dose-dependent DEB lesion-forming response within "open" chromatin. DEB appears to have little-to-no effect upon regions of "closed" chromatin.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Development of a real-time PCR method for rapid sexing of human preimplantation embryos

Genes on the X chromosome are known to be responsible for more than 200 hereditary diseases. After IVF, the simple selection of embryo sex before uterine transfer can prevent the occurrence of affected offspring among couples at risk for these genetic disorders. The aim of this investigation was to develop a rapid method of preimplantation genetic diagnosis (PGD) using real-time polymerase chain reaction (PCR) for the sexing of human embryos, and to compare it to the fluorescence in-situ hybridization technique, considered to be the gold standard. After biopsies were obtained from 40 surplus non-viable embryos for transfer, a total of 98 blastomeres were analysed. It was possible to analyse 24 embryos (60%) by both techniques, generating a total of 70 blastomeres (35 per technique), white 28 blastomeres from 16 embryos (40%) were analysed only by real-time PCR. A rapid and safe method was developed in the present study for the sexual diagnosis of a single human cell (blastomere and buccal cell) using the emerging technology of real-time PCR. (C) 2009, Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Identification of sexually dimorphic gene expression in brain tissue of the fish Leporinus macrocephalus through mRNA differential display and real time PCR analyses

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Validation of a reference control for an SYBR-Green fluorescence assay-based real-time PCR for detection of bovine herpesvirus 5 in experimentally exposed bovine embryos

The objective of this study was to optimize an internal control to improve SYBR-Green-based qPCR to amplify/detect the BoHV-5 US9 gene in bovine embryos produced invitro and experimentally exposed to the virus. We designed an SYBR-Green-based binding assay that is quick to perform, reliable, easily optimized and compares well with the published assay. Herein we demonstrated its general applicability to detect BoHV-5 US9 gene in bovine embryos produced invitro experimentally exposed to BoHV-5. In order to validate the assay, three different reference genes were tested; and the histone 2a gene was shown to be the most adequate for normalizing the qPCR reaction, by considering melting and standard curves ( p<0.05). On the other hand, no differences were found in the development of bovine embryos invitro whether they were exposed to BoHV-5 reference and field strains comparing to unexposed embryos. The developed qPCR assay may have important field applications as it provides an accurate BoHV-5 US9 gene detection using a proven reference gene and is considerably less expensive than the TaqMan qPCR currently employed in sanitary programs. © 2013 Elsevier Ltd.

Metabolismo respiratório de bradirrizóbios em processos “in vitro” e simbióticos analisado por PCR quantitativo em tempo real

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Análise da expressão dos genes STEAP1 e STEAP2 em adenocarcinomas de próstata por RT-PCR quantitativa em tempo real

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Avaliação da microbiota presente na mucosa intestinal de frangos de corte alimentados com ração à base de milho ou sorgo através de PCR em tempo real

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Carga proviral do HTLV-1 e HTLV-2: um método simples através da PCR quantitativa em tempo real

Os vírus linfotrópicos de células T humanas, quando integrados ao genoma da célula hospedeira, provírus, têm como marcador de replicação seu DNA proviral. A carga proviral parece ser um importante fator no desenvolvimento de patologias associadas a estes retrovírus. Neste estudo foi desenvolvida uma metodologia para quantificação absoluta da carga proviral dos HTLV-1 e HTLV-2 através da PCR em tempo real. Cinqüenta e três amostras de doadores de sangue com teste de ELISA reagente foram submetidas à metodologia, que utilizou o sistema TaqMan® para três seqüências alvo: HTLV-1, HTLV-2 e albumina. A quantificação proviral absoluta foi determinada através da proporção relativa entre o genoma do HTLV e o genoma da célula hospedeira, levando em consideração o número de leucócitos. O método apresentado é sensível (215 cópias/mL), prático e simples para quantificação proviral, além de eficiente e adequado para confirmação e discriminação da infecção pelos tipos virais.

Fluorescent antibody test, quantitative polymerase chain reaction pattern and clinical aspects of rabies virus strains isolated from main reservoirs in Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)