Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Fluoride Concentrations In The Water Of Maringá, Brazil, Considering The Benefit/risk Balance Of Caries And Fluorosis.

Current Brazilian law regarding water fluoridation classification is dichotomous with respect to the risks of and benefits for oral diseases, and fluoride (F) concentrations less than 0.6 or above 0.8 mg F/L are considered outside the normal limits. Thus, the law does not consider that both caries and fluorosis are dependent on the dosage and duration of fluoride exposure because they are both chronic diseases. Therefore, this study evaluated the quality of water fluoridation in Maringá, PR, Brazil, considering a new classification for the concentration of F in water the supply, based on the anticaries benefit and risk of fluorosis (CECOL/USP, 2011). Water samples (n = 325) were collected monthly over one year from 28 distribution water networks: 20 from treatment plants and 8 from artesian wells. F concentrations were determined using a specific ion electrode. The average F concentration was 0.77 mg F/L (ppm F), ranging from 0.44 to 1.22 mg F/L. Considering all of the water samples analyzed, 83.7% of them presented from 0.55 to 0.84 mg F/L, and according to the new classification used, they would provide maximum anticaries benefit with a low risk of fluorosis. This percentage was lower (75.4%) in the water samples supplied from artesian wells than from those distributed by the treatment plant (86%). In conclusion, based on the new classification of water F concentrations, the quality of water fluoridation in Maringá is adequate and is within the range of the best balance between risk and benefit.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Análise de custo-efetividade de métodos preventivos para superfície oclusal de acordo com o risco de cárie: resultados de um ensaio clínico controlado

This study presents the results of a cost-effectiveness analysis in a controlled clinical trial on the effectiveness of a modified glass ionomer resin sealant ( Vitremer, 3M ESPE) and the application of fluoride varnish (Duraphat, Colgate) on occlusal surfaces of first permanent molars in children 6-8 years of age (N = 268), according to caries risk (high versus low). Children were examined semiannually by the same calibrated dentist for 24 months after allocation in six groups: high and low risk controls (oral health education every three months); high and low risk with varnish (oral health education every three months + varnish biannually); and high and low risk with sealant (oral health education every three months + a single application of sealant). Economic analysis showed that sealing permanent first molars of high-risk schoolchildren showed a C/E ratio of US$ 119.80 per saved occlusal surface and an incremental C/E ratio of US$ 108.36 per additional saved occlusal surface. The study concluded that sealing permanent first molars of high-risk schoolchildren was the most cost-effective intervention.

Efeito cariostático de restaurações adesivas em superfícies radiculares: estudo in vitro

Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dental caries profile in Monte Negro, Amazonian state of Rondônia, Brazil, in 2008

OBJECTIVE: This epidemiological survey assessed the dental caries profile in Monte Negro, a small town in the Amazonian state of Rondônia, Brazil, and its relationship with the northern region, national and global goals for oral health in the years 2000 and 2020. MATERIAL AND METHODS: The groups randomly examined were composed of individuals aged 5, 12, 15 to 19, 35 to 44, 65 to 74 years, living in both rural and urban areas. RESULTS: The means dft (standard deviation) and DMFT (standard deviation) for the groups were, respectively, 3.15 (3.12), 3.41 (2.69), 5.96 (4.19), 16.00 (7.30) and 25.96 (9.82). Caries-free individuals were 34.42%, 14.81% and 8.16% in the preschoolchildren, schoolchildren and adolescent groups, respectively. The Significant Caries Index percentages applied to the two younger groups were 6.65 and 6.70, and they increased to 32.00 in the individuals aged 65 to 74 years. Care Index percentages for adolescents, adults and elderly groups were, respectively, 29.40, 25.00 and 1.41. The dental caries profile in Monte Negro in 2008 shows that, 8 years after the year 2000, no FDI/WHO goal for any age settled in 1982 has been achieved. Dental caries increased with age and the main dental problem of adult and elderly groups was tooth loss. CONCLUSION: Oral health promotion and prevention of oral disease policies are urgent needs. Setting of oral health goals and targets to people living in Monte Negro or Amazonia to be pursuit and achieved in a near future is an important action to do because of the culture, sanitary conditions and socioeconomic aspects of this particular population.

Class II malocclusion occlusal severity description

OBJECTIVES: It is well known that the efficacy and the efficiency of a Class II malocclusion treatment are aspects closely related to the severity of the dental anteroposterior discrepancy. Even though, sample selection based on cephalometric variables without considering the severity of the occlusal anteroposterior discrepancy is still common in current papers. In some of them, when occlusal parameters are chosen, the severity is often neglected. The purpose of this study is to verify the importance given to the classification of Class II malocclusion, based on the criteria used for sample selection in a great number of papers published in the orthodontic journal with the highest impact factor. MATERIAL AND METHODS: A search was performed in PubMed database for full-text research papers referencing Class II malocclusion in the history of the American Journal of Orthodontics and Dentofacial Orthopedics (AJO-DO). RESULTS: A total of 359 papers were retrieved, among which only 72 (20.06%) papers described the occlusal severity of the Class II malocclusion sample. In the other 287 (79.94%) papers that did not specify the anteroposterior discrepancy severity, description was considered to be crucial in 159 (55.40%) of them. CONCLUSIONS: Omission in describing the occlusal severity demands a cautious interpretation of 44.29% of the papers retrieved in this study.

Knowledge and attitude of parents or caretakers regarding transmissibility os caries disease

Dental caries is a transmissible infectious disease in which mutans streptococci are generally considered to be the main etiological agents. Although the transmissibility of dental caries is relatively well established in the literature, little is known whether information regarding this issue is correctly provided to the population. The present study aimed at evaluating, by means of a questionnaire, the knowledge and usual attitude of 640 parents and caretakers regarding the transmissibility of caries disease. Most interviewed adults did not know the concept of dental caries being an infectious and transmissible disease, and reported the habit of blowing and tasting food, sharing utensils and kissing the children on their mouth. 372 (58.1%) adults reported that their children had already been seen by a dentist, 264 (41.3%) answered that their children had never gone to a dentist, and 4 (0.6%) did not know. When the adults were asked whether their children had already had dental caries, 107 (16.7%) answered yes, 489 (76.4%) answered no, and 44 (6.9%) did not know. Taken together, these data reinforce the need to provide the population with some important information regarding the transmission of dental caries in order to facilitate a more comprehensive approach towards the prevention of the disease.

Dental caries and related factors in Brazilian children from fluoridated and non-fluoridated areas

PURPOSE: To compare the caries prevalence, saliva buffering capacity (SBC), oral hygiene (OH), dietary habits, family income (FI) and frequency of visits to a dental office (Do) between Brazilian children living in areas with and without fluoridated public water supply. METHODS: Forty-six 5-7-year-old preschoolers were selected in Itatiba, SP, Brazil; 19 were from a fluoridated area, and 27 were from a non-fluoridated area. The caries index was determined according to the World Health Organization criteria, and the SBC was assessed by titration with hydrochloric acid. The FI, frequency of OH and visits to Do were estimated by questionnaire. The dietary habits were assessed with a diet chart. The differences between the groups were analyzed with Mann-Whitney-U tests (α=0.05). RESULTS: Children from the non-fluoridated area showed significantly higher dmft/DMFT than those from the fluoridated area, but they showed significantly lower SBC, OH frequency and FI. No significant differences were observed between the areas for dietary habits and visits to Do. CONCLUSION: Children from fluoridated areas showed higher salivary buffering capacity, family income and oral hygiene frequency as well as lower caries prevalence, supporting the beneficial effect of fluoride in the tap water for caries prevention.

Effect of drying on the reproducibility of DIAGNOdent to detect caries-like lesions

The aim of this study was to verify the drying effect on the reproducibility of DIAGNOdent (Dd) devices to detect caries-like lesions. Three areas were created in each of the 34 bovine incisors: sound (S), demineralized (DE) and remineralized (RE). One examiner measured each area with two Dd devices (denominated X and Y), twice under humid, and twice under dry condition. Intra-rater agreement according each device and inter-device agreement were estimated by kappa statistics (k). Intra-rater agreement for device Y was substantial under humid (k DE=0.68 and k RE+S=0.68) and dry condition (k DE=0.64 and k RE+S=0.67). For device X, it was substantial under humid condition (k DE=0.57 and k RE+S=0.49), and it was almost perfect after air drying (k DE=1.0 and kRE+S=1.0). Inter-device agreement was slight (k =0.17) under humid condition, and it was substantial under dry condition (k =0.62). As reproducibility increased under dry condition, drying is advised to detect caries-like lesions on free smooth surfaces when different devices are used.

Analysis of TMJ vibration sounds before and after use of two types of occlusal splints

Temporomandibular joint (TMJ) sounds are important and common physical signs of temporomandibular disorders (TMD). The aim of this study was to evaluate the influence of the effect of the use of occlusal bite splints (stabilizing and repositioning) on the sounds produced in the TMJ, by means of the electrovibratography (EVG). Thirty-one patients with TMD from the Dental School of Ribeirão Preto, University of São Paulo, Brazil were selected for this study. Group 1 (n=23) wore stabilizing bite splints and Group 2 (n=8) used anterior repositioning splints. Before and after treatment with occlusal splints both groups were analyzed using the SonoPAK Q/S recording system (BioResearch System, Inc.). The treatments with stabilizing bite splints were satisfactory, since they reduced the total amount of the sound energies (p<0.05), but the use of anterior repositioning splints for no more than 4 weeks produced significantly better results (p<0.01). The total amount of vibration energy involved in the vibrating movements of the TMJ showed significant improvement using anterior repositioning splints.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.