917 resultados para Frozen fruit juices.


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The patient's diet has been considered an important etiological factor of dentin hypersensitivity. The frequent ingestion of acidic substances can promote the loss of dental structure or remove the smear layer. The purpose of this study was to evaluate the degree of smear layer removal and dentinal tubules exposure by different natural orange juices. Extracted human teeth were submitted to manual scaling in order to develop the smear layer. Seventy dentin samples were obtained and distributed into the following groups: Control, lime orange, lime, valência orange, navel orange, mandarin, and tangerine. Each group included 2 methods of application: Topical and topical + friction. After preparation for SEM analysis, photomicrographs were assessed by a blind calibrated examiner using an index system. The Kruskal-Wallis test indicated a significant influence of the orange juices on smear layer removal. Significant difference was observed between navel orange, valência orange, mandarin and the control group (p < 0.05). These orange juices resulted in greater removal of the smear layer and greater opening of dentinal tubules. The comparison between the application methods for each group using the Mann-Whitney test showed that friction increased smear layer removal significantly only for lime orange and lime. The data suggest that certain natural orange juices are more effective in terms of smear layer removal and dentinal tubules exposure than others.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Purpose: This in vitro study aimed to evaluate the effect of different fruit juice drinks available in the Brazilian market on smear layer removal and dentinal tubules opening, as well as to verify the effect of toothbrushing subsequently to the juices exposure. Methods: Dentin specimens were prepared and randomly distributed into the control group (distilled water) and twelve types of fruit juice drinks (cashew, orange, mandarin, apple, passion fruit, guava, strawberry, grape, mango, pear, peach, pineapple). The following treatments were applied: immersion or immersion + brushing. After preparation for SEM, photomicrographs were assessed using an index of smear layer removal. Results: No significant differences regarding smear layer removal and dentinal tubules exposure could be observed between the groups after both treatments (Kruskal-Wallis, post-hoc paired comparisons, P>0.05). The control solution and the fruit juice drinks were not able to remove smear layer and to open dentinal tubules. Significant difference between the applied treatments was detected only for the mango juice group (Mann-Whitney, P<0.05). Conclusion: Under the experimental conditions, the different fruit juice drinks did not promote significant alterations on human radicular dentin morphology regardless of the subsequent application of brushing procedures. Copyright: © 2011 Zandim et al.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Tropical fruit residues consisting of seeds, peels and residual pulp generated as by-products of fruit processing industry were investigated for bioactive compounds, the in vitro antioxidant capacity as well as alpha-glucosidase and alpha-amylase inhibitory activities. Cyanidin, quercetin, ellagic acid (EA) and proanthocyanidins were found in acerola, jambolan, pitanga and caja-umbu residue powders. Acerola powder had the highest phenolic content (8839.33 mg catechin equivalents (CE)/100 g) and also high-ascorbic acid (AA) concentration (2748.03 mg/100 g), followed by jambolan and pitanga. The greatest 1,1-Diphenyl-2-picrylhydrazyl (DPPH) inhibition was observed for jambolan (436.76 mmol Trolox eq/g) followed by pitanga (206.68 mmol Trolox eq/g) and acerola (192.60 mmol Trolox eq/g), while acerola had the highest ferric reducing antioxidant power (FRAP) assay result (7.87 mmol Trolox eq/g). All fruit powders exhibited enzymatic inhibition against alpha-amylase (IC50 ranging from 3.40 to 49.5 mg CE/mL) and alpha-glucosidase (IC50 ranging from 1.15 to 2.37 mg CE/mL). Therefore, acerola, jambolan and pitanga dried residues are promising natural ingredients for food and nutraceutical manufacturers, due to their rich bioactive compound content.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The purpose of the present study was to evaluate the erosive potential of different types (concentrated and powdered) and commercial brands of industrialised grape juices. The pH of all five fruit drinks was measured at two time points: immediately after preparation and 24 hours later. Sixty specimens of bovine enamel were randomly allocated and immersed in different types of grape juice (n = 10) for 10 minutes four times a day for fifteen days. The enamel alteration was analysed using surface Knoop microhardness (KHN) and surface roughness (R-a) tests at baseline and on the 5th, 10th and 15th days of the experiment. Two way ANOVA, Tukey's post hoc and Pearson's correlation tests were used for statistical analysis (alpha = 5%). The grape juices presented pH values ranging from 2.9 to 3.5. All of the tested juices promoted significant enamel mineral loss (p < 0.05) on the first evaluation (5th day of immersion) and produced a significant increase in the mean roughness from the 10th day on when compared to the control group (p < 0.05). By the 15th day, all of the beverages had produced surface roughnesses that were significantly higher than that of the control group. The results suggest that all grape juices, regardless of their commercial presentation, present erosive potential.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Brown rot caused by Monilinia laxa and Monilinia fructigena is considered one of the most important diseases affecting Prunus species. Although some losses can result from the rotten fruits in the orchard, most of the damage is caused to fruits during the post-harvest phase. Several studies reported that brown rot incidence during fruit development highly varies; it was found that at a period corresponding to the the pit hardening stage, fruit susceptibility drastically decreases, to be quickly restored afterwards. However the molecular basis of this phenomenon is still not well understood. Furthermore, no difference in the rot incidence was found between wound and un-wound fruits, suggesting that resistance associated more to a specifc biochemical response of the fruit, rather than to a higher mechanical resistance. So far, the interaction Monilinia-peach was analyzed through chemical approaches. In this study, a bio-molecular approach was undertaken in order to reveal alteration in gene expression associated to the variation of susceptibility. In this thesis three different methods for gene expression analysis were used to analyze the alterations in gene expression occurring in peach fruits during the pit hardening stage, in a period encompassing the temporary change in Monilinia susceptibility: real time PCR, microarray and cDNA AFLP techniques. In 2005, peach fruits (cv.K2) were weekly harvested during a 19-week long-period, starting from the fourth week after full bloom, until full maturity. At each sampling time, three replicates of 5 fruits each were dipped in the M.laxa conidial suspension or in distilled water, as negative control. The fruits were maintained at room temperature for 3 hours; afterwards, they were peeled with a scalpel; the peel was immediately frozen in liquid nitrogen and transferred to -80 °C until use. The degree of susceptibility of peach fruit to the pathogen was determined on 3 replicates of 20 fruits each, as percentage of infected fruits, after one week at 20 °C. Real time PCR analysis was performed to study the variation in expression of those genes encoding for the enzymes of the phenylpropanoid pathway (phenylalanine ammonia lyase (PAL), chalcone synthase (CHS), cinnamate 4-hydroxylase (C4H), leucoanthocyanidine reductase (LAR), hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase (HQT) and of the jasmonate pathway, such as lipoxygenase (LOX), both involved in the production of important defense compounds. Alteration in gene expression was monitored on fruit samples of a period encompassing the pit hardening stage and the corresponding temporary resistance to M.laxa infections, weekly, from the 6thto the 12th week after full bloom (AFB) inoculated with M. laxa or mock-inoculated. The data suggest a critical change in the expression level of the phenylpropanoid pathway from the 7th to the 8th week AFB; such change could be directly physiologically associated to the peach growth and it could indirectly determine the decrease of susceptibility of peach fruit to Monilinia rot during the subsequent weeks. To investigate on the transcriptome variation underneath the temporary loss of susceptibility of peach fruits to Monilinia rot, the microarray and the cDNA AFLP techniques were used. The samples harvested on the 8th week AFB (named S, for susceptible ones) and on the 12th week AFB (named R, for resistant ones) were compared, both inoculated or mock-inoculated. The microarray experiments were carried out at the University of Padua (Dept. of Environmental Agronomy and Crop Science), using the μPEACH1.0 microarray together with the suited protocols. The analysis showed that 30 genes (corresponding to the 0.6% of the total sequences (4806) contained in the μPeach1.0 microarray) were found up-regulated and 31 ( 0.6%) down regulated in RH vs. SH fruits. On the other hand, 20 genes (0.4%) were shown to be up-regulated and 13 (0.3%) down-regulated in the RI vs. SI fruit. No genes were found differentially expressed in the mock-inoculated resistant fruits (RH) vs. the inoculated resistant ones (RI). Among the up-regulated genes an ATP sulfurylase, an heat shock protein 70, the major allergen Pru P1, an harpin inducing protein and S-adenosylmethionine decarboxylase were found, conversely among the down-regulated ones, cinnamyl alcohol dehydrogenase, an histidine- containing phosphotransfer protein and the ferritin were found. The microarray experimental results and the data indirectly derived, were tested by Real Time PCR analysis. cDNA AFLP analysis was also performed on the same samples. 339 transcript derived fragments considered significant for Monilinia resistance, were selected, sequenced and classified. Genes potentially involved in cell rescue and defence were well represented (8%); several genes (12.1%) involved in the protein folding, post-transductional modification and genes (9.2%) involved in cellular transport were also found. A further 10.3% of genes were classified as involved in the metabolism of aminoacid, carbohydrate and fatty acid. On the other hand, genes involved in the protein synthesis (5.7%) and in signal transduction and communication (5.7%) were found. Among the most interesting genes found differentially expressed between susceptible and resistant fruits, genes encoding for pathogenesis related (PR) proteins were found. To investigate on the association of Monilinia resistance and PR biological function, the major allergen Pru P1 (GenBank accession AM493970) and its isoform (here named Pru P2), were expressed in heterologous system and in vitro assayed for their anti-microbial activity. The ribonuclease activity of the recombinant Pru P1 and Pru P2 proteins was assayed against peach total RNA. As the other PR10 proteins, they showed a ribonucleolytic activity, that could be important to contrast pathogen penetration. Moreover Pru P1 and Pru P2 recombinant proteins were checked for direct antimicrobial activity. No inhibitory effect of Pru P1 or Pru P2 was detected against the selected fungi.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This work evaluated the fresh, spray dried (with 10 % of Arabic Gum) and freeze dried jambolan pulp (Eugenia jambolana Lam.) in regard to physicochemical (pH, moisture, water activity, average particle diameter, solubility and color), bioactive [total phenolic content (TPC), monomeric anthocyanin, pronathocyanidin (PA), total elagic acid (TEA), myricetin and cyanidin] and in vitro functionality (antioxidant, antienzymatic and antimicrobial activities]. In addition, the in vivo functionality of jambolan pulp was investigated using the Caenorhabditis elegans model for insulin signaling, longevity and induced neurodegeneration (Alzheimer’s disease and Parkinson’s disease related symptoms). The dried jambolan pulp presented TPC retention (50% to 75%), PA (90% to 98%), TEA (31% to 83%), myricetin (40% to 84%), cyanidin (72% to 84%) and antioxidant activity (15%). The fresh jambolan pulp, the freeze dried pulp and the spray dried jambolan pulp presented high enzymatic inhibitory activity against pancreatic lipase (4,4 to 5,8 mg/mL), alpha-glycosidase (10,3 to 13,8 mg/mL) and alpha-amylase (8,9 to 11,2 mg/mL). They also were active inhibitors against the pathogen S. aureus. The dried jambolan experimental samples were able to increase the expression of several genes linked to the insulin signaling pathways (SIR-2.1, PPTR-1, DAF-16, SOD-3, e CTL) and increased the lifespan in C. elegans (18,07 % - 24,34 %), besides decreasing the amyloid AB1-42 aggregation induced paralysis and MPP+ (1-methyl-4-phenylpyridinium) induced neurodegeneration. Based on that, the jambolan pulp and the spray dried jambolan pulp were further selected for the production of caprine frozen yogurt with the addition of Bifidobacterium animalis subsp. lactis BI-07. The final product were evaluated in regard to their physicochemical (pH, acidity, total solids, protein, total reducing sugars, fat, ashes, overrun, melting test), bioactive (TPC and monomeric anthocyanin, antioxidant activity, probiotic viability and sensory analysis (sensory acceptance). The results showed that samples with probiotic had lowest pH and higher acidity, TPC, anthocyanin and antioxidant activity. It was also observed low overrun (14.2% to 22.6%). vi Samples with probiotic had lower flavor scores. Overall, this research presents the jambolan as a highly functional bioactive-rich fruit with the potential to modulate important biological pathways, extend lifespan and retard the development of neurodegenerative diseases. Jambolan is an underexploited exotic fruit with a high colorant potential and this thesis shows for the first time in the literature important technological, biological and scientific data about this fruit that could be used towards the development of health-oriented food products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Flavanones (hesperidin, naringenin, naringin, and poncirin) in industrial, hand-squeezed orange juices and from fresh-in-squeeze machines orange juices were determined by HPLC/DAD analysis using a previously described liquid-liquid extraction method. Method validation including the accuracy was performed by using recovery tests. Samples (36) collected from different Brazilian locations and brands were analyzed. Concentrations were determined using an external standard curve. The limits of detection (LOD) and the limits of quantification (LOQ) calculated were 0.0037, 1.87, 0.0147, and 0.0066 mg 100 g(-1) and 0.0089, 7.84, 0.0302, and 0.0200 mg 100 g(-1) for naringin, hesperidin, poncirin, and naringenin, respectively. The results demonstrated that hesperidin was present at the highest concentration levels, especially in the industrial orange juices. Its average content and concentration range were 69.85 and 18.80-139.00 mg 100 g(-1). The other flavanones showed the lowest concentration levels. The average contents and concentration ranges found were 0.019, 0.01-0.30, and 0.12 and 0.1-0.17, 0.13, and 0.01-0.36 mg 100 g(-1), respectively. The results were also evaluated using the principal component analysis (PCA) multivariate analysis technique which showed that poncirin, naringenin, and naringin were the principal elements that contributed to the variability in the sample concentrations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.