Professional race car driver Janet Guthrie

General note: Title and date provided by Bettye Lane.

Las Cruces, New Mexico Balloon Race

General note: Title and date provided by Bettye Lane.

Las Cruces, New Mexico Balloon Race

General note: Title and date provided by Bettye Lane.

Changes in race-specific virulence in pseudomonas syringae pv. phaseolicola are Associated with a chimeric transposable element and rare deletion events in a plasmid-borne pathogenicity island

Virulence for bean and soybean is determined by effector genes in a plasmid-borne pathogenicity island (PAI) in race 7 strain 1449B of Pseudomonas syringae pv. phaseolicola. One of the effector genes, avrPphF, confers either pathogenicity, virulence, or avirulence depending on the plant host and is absent from races 2, 3, 4, 6, and 8 of this pathogen. Analysis of cosmid clones and comparison of DNA sequences showed that the absence of avrPphF from strain 1448A is due to deletion of a continuous 9.5-kb fragment. The remainder of the PAI is well conserved in strains 1448A and 1449B. The left junction of the deleted region consists of a chimeric transposable element generated from the fusion of homologs of IS1492 from Pseudomonas putida and IS1090 from Ralstonia eutropha. The borders of the deletion were conserved in 66 P. syringae pv. phaseolicola strains isolated in different countries and representing the five races lacking avrPphF. However, six strains isolated in Spain had a 10.5-kb deletion that extended 1 kb further from the right junction. The perfect conservation of the 28-nucleotide right repeat of the IS1090 homolog in the two deletion types and in the other 47 insertions of the IS1090 homolog in the 1448A genome strongly suggests that the avrPphF deletions were mediated by the activity of the chimeric mobile element. Our data strongly support a clonal origin for the races of P. syringae pv. phaseolicola lacking avrPphF.

Retrospective evaluation of all recorded horse race starts in Switzerland during a four-year period focusing on discipline specific risk factors for clinical events

REASONS FOR PERFORMING THE STUDY: Racetrack injuries are of welfare concern and prevention of injuries is an important goal in many racing jurisdictions. Over the years this has led to more detailed recording of clinical events on racecourses. However, risk factor analyses of clinical events at race meetings have never been reported for Switzerland OBJECTIVE: To identify discipline-specific factors that influence the occurrence of clinical events during race meetings with the ultimate aim to improve the monitoring and safety on racetracks in Switzerland and optimise racehorse welfare. STUDY DESIGN: Retrospective study of horse race data collected by the Swiss horse racing association. METHODS: All race starts (n = 17,670, including 6,198 flat, 1,257 obstacle and 10,215 trot race starts) recorded over a period of four years (2009-2012) were analysed in multivariable mixed effect logistic regression models including horse and racecourse related data. The models were designed to identify discipline specific factors influencing the occurrence of clinical events on racecourses in Switzerland. RESULTS: Factors influencing the risk of clinical events during races were different for each discipline. The risk of a clinical event in trot racing was lower for racing on a Porphyre-sand track than on grass tracks. Horses whose driver was also their trainer had an approximately two times higher risk for clinical events. In obstacle races, longer distances (2401-3300 m and 3301-5400 m respectively) had a protective effect compared to racing over shorter distances. In flat racing, five racecourses reported significantly less clinical events. In all three disciplines, finishing 8th place or later was associated with clinical events. CONCLUSIONS: Changes in management that aim to improve the safety and welfare of racehorses, such as racetrack adaptations, need to be individualised for each discipline.

Longitudinal and logistic analysis of endocrine hormone profiles, physical maturation, and candidate genes related to pubertal events in children

Children who experience early pubertal development have an increased risk of developing cancer (breast, ovarian, and testicular), osteoporosis, insulin resistance, and obesity as adults. Early pubertal development has been associated with depression, aggressiveness, and increased sexual prowess. Possible explanations for the decline in age of pubertal onset include genetics, exposure to environmental toxins, better nutrition, and a reduction in childhood infections. In this study we (1) evaluated the association between 415 single nucleotide polymorphisms (SNPs) from hormonal pathways and early puberty, defined as menarche prior to age 12 in females and Tanner Stage 2 development prior to age 11 in males, and (2) measured endocrine hormone trajectories (estradiol, testosterone, and DHEAS) in relation to age, race, and Tanner Stage in a cohort of children from Project HeartBeat! At the end of the 4-year study, 193 females had onset of menarche and 121 males had pubertal staging at age 11. African American females had a younger mean age at menarche than Non-Hispanic White females. African American females and males had a lower mean age at each pubertal stage (1-5) than Non-Hispanic White females and males. African American females had higher mean BMI measures at each pubertal stage than Non-Hispanic White females. Of the 415 SNPs evaluated in females, 22 SNPs were associated with early menarche, when adjusted for race ( p<0.05), but none remained significant after adjusting for multiple testing by False Discovery Rate (p<0.00017). In males, 17 SNPs were associated with early pubertal development when adjusted for race (p<0.05), but none remained significant when adjusted for multiple testing (p<0.00017). ^ There were 4955 hormone measurements taken during the 4-year study period from 632 African American and Non-Hispanic White males and females. On average, African American females started and ended the pubertal process at a younger age than Non-Hispanic White females. The mean age of Tanner Stage 2 breast development in African American and Non-Hispanic White females was 9.7 (S.D.=0.8) and 10.2 (S.D.=1.1) years, respectively. There was a significant difference by race in mean age for each pubertal stage, except Tanner Stage 1 for pubic hair development. Both Estradiol and DHEAS levels in females varied significantly with age, but not by race. Estradiol and DHEAS levels increased from Tanner Stage 1 to Tanner Stage 5.^ African American males had a lower mean age at each Tanner Stage of development than Non-Hispanic White males. The mean age of Tanner Stage 2 genital development in African American and Non-Hispanic White males was 10.5 (S.D.=1.1) and 10.8 (S.D.=1.1) years, respectively, but this difference was not significant (p=0.11). Testosterone levels varied significantly with age and race. Non-Hispanic White males had higher levels of testosterone than African American males from Tanner Stage 1-4. Testosterone levels increased for both races from Tanner Stage 1 to Tanner Stage 5. Testosterone levels had the steepest increase from ages 11-15 for both races. DHEAS levels in males varied significantly with age, but not by race. DHEAS levels had the steepest increase from ages 14-17. ^ In conclusion, African American males and females experience pubertal onset at a younger age than Non-Hispanic White males and females, but in this study, we could not find a specific gene that explained the observed variation in age of pubertal onset. Future studies with larger study populations may provide a better understanding of the contribution of genes in early pubertal onset.^

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Ciclimo de velocidade : uma proposta de controle da preparação fisica especial

Universidade Estadual de Campinas . Faculdade de Educação Física

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Engagement of multifocal neural circuits during recall of autobiographical happy events

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

High-energy events and short-term changes in superficial beach sediments

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Surveillance for adverse events after DTwP/Hib vaccination in Brazil: sensitivity and factors associated with reporting

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use

Transforming Youth Identities: Interactions Across ""Races/Colors/Ethnicities,"" Gender, Class, and Sexualities in Johannesburg, South Africa

In South Africa, and especially in Johannesburg, apartheid's ""racial"" paradigms are being transformed. Fifteen years after the end of apartheid and the elimination of all forms of inequity based on notion of ""race,"" including the abolition of the Immorality Act of 1949 that prohibited mixed marriages, the discourses of youth challenge preestablished boundaries. Today, the South African Constitution gives people the right to proclaim their sexual orientation and to shape their own identities. Through ethnographic observations carried out in Johannesburg and in-depth interviews with young people, this paper explores transforming notions of identity based on ""race/color/ethnicity,"" gender, class, and sexuality. The dynamics and challenges faced by young people with regards to mixed interactions in post-apartheid Johannesburg are analyzed and the paper looks at how "" race,"" gender, and sexuality interact in the various spaces in Johannesburg and how they affect young people's lives, particularly their perceptions of risk, violence, and HIV/AIDS vulnerability.

Genetic Variants of Diabetes Risk and Incident Cardiovascular Events in Chronic Coronary Artery Disease

Objective: To determine whether information from genetic risk variants for diabetes is associated with cardiovascular events incidence. Methods: From the about 30 known genes associated with diabetes, we genotyped single-nucleotide polymorphisms at the 10 loci most associated with type-2 diabetes in 425 subjects from the MASS-II Study, a randomized study in patients with multi-vessel coronary artery disease. The combined genetic information was evaluated by number of risk alleles for diabetes. Performance of genetic models relative to major cardiovascular events incidence was analyzed through Kaplan-Meier curve comparison and Cox Hazard Models and the discriminatory ability of models was assessed for cardiovascular events by calculating the area under the ROC curve. Results: Genetic information was able to predict 5-year incidence of major cardiovascular events and overall-mortality in non-diabetic individuals, even after adjustment for potential confounders including fasting glycemia. Non-diabetic individuals with high genetic risk had a similar incidence of events then diabetic individuals (cumulative hazard of 33.0 versus 35.1% of diabetic subjects). The addition of combined genetic information to clinical predictors significantly improved the AUC for cardiovascular events incidence (AUC = 0.641 versus 0.610). Conclusions: Combined information of genetic variants for diabetes risk is associated to major cardiovascular events incidence, including overall mortality, in non-diabetic individuals with coronary artery disease.