984 resultados para X-ray diffraction crystallography


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A robust, direct, rapid and non-destructive X-ray diffraction crystallography method to detect the polyprenylated benzophenones 7-epi-clusianone (1) and guttiferone A (2) in extracts from Garcinia brasiliensis is presented. Powder samples of benzophenones 1 and 2, dried hexane extracts from G. brasiliensis seeds and fruit`s pericarp, and the dried ethanolic extract from G. brasiliensis seeds were unambiguously characterized by powder X-ray diffractometry. The calculated X-ray diffraction peaks from crystal structures of analytes 1 and 2, previously determined by single-crystal X-ray diffraction technique, were overlaid to those of the experimental powder diffractograms, providing a practical identification of these compounds in the analyzed material and confirming the pure contents of the powder samples. Using the X-ray diffraction crystallography method, the studied polyprenylated benzophenones were selectively and simultaneously detected in the extracts which were mounted directly on sample holder. In addition, reference materials of the analytes were not required for analyses since the crystal structures of the compounds are known. High performance liquid chromatography analyses also were comparatively carried out to quantify the analytes in the same plant extracts showing to be in agreement with X-ray diffraction crystallography method. (C) 2010 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Glutathione S-transferases (GSTs) form a group of multifunctional isoenzymes that catalyze the glutathione-dependent conjugation and reduction reactions involved in the cellular detoxification of xenobiotic and endobiotic compounds. GST from Xylella fastidiosa (xfGST) was overexpressed in Escherichia coli and purified by conventional affinity chromatography. In this study, the crystallization and preliminary X-ray analysis of xfGST is described. The purified protein was crystallized by the vapour-diffusion method, producing crystals that belonged to the triclinic space group P1. The unit-cell parameters were a = 47.73, b = 87.73, c = 90.74 angstrom, alpha = 63.45, beta = 80.66, gamma = 94.55 degrees. xfGST crystals diffracted to 2.23 angstrom resolution on a rotating-anode X-ray source.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Interleukin-22 (IL-22) is a pleiotropic cytokine that is involved in inflammatory responses. Human IL-22 was incubated with its soluble decoy receptor IL-22BP (IL-22 binding protein) and the IL-22 -IL-22BP complex was crystallized in hanging drops using the vapour-diffusion method. Suitable crystals were obtained from polyethylene glycol solutions and diffraction data were collected to 2.75 angstrom resolution. The crystal belonged to the tetragonal space group P41, with unit-cell parameters a = b = 67.9, c = 172.5 angstrom, and contained two IL-22-IL- 22BP complexes per asymmetric unit.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Time-averaged conformations of (+/-)-1-[3,4-(methylenedioxy)phenyl]-2-methylaminopropane hydrochloride (MDMA, ""ecstasy"") in D(2)O, and of its free base and trifluoroacetate in CDCl(3), were deduced from their (1)H NMR spectra and used to calculate their conformer distribution. Their rotational potential energy surface (PES) was calculated at the RHF/6-31G(d,p), 133LYP/6-31G(d,p), B3LYP/cc-pVDZ and AM1 levels. Solvent effects were evaluated using the polarizable continuum model. The NMR and theoretical studies showed that, in the free base, the N-methyl group and the ring are preferentially trans. This preference is stronger in the salts and corresponds to the X-ray structure of the hydrochloride. However, the energy barriers separating these forms are very low. The X-ray diffraction crystal structures of the anhydrous salt and its monohydrate differed mainly in the trans or cis relationship of the N-methyl group to the a-methyl, although these two forms interconvert freely in solution. (C) 2007 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The oxidized form of purple acid phosphatase from pig allantoic fluid has been crystallized in the presence of phosphate using the hanging-drop technique. The crystals belong to the space group P2(1)2(1)2(1) and have unit-cell parameters a = 66.8, b = 70.3, c = 78.7 Angstrom. Diffraction data collected from a cryocooled crystal using a conventional X-ray source extend to 1.55 Angstrom resolution. A knowledge of the three-dimensional structure of mammalian purple acid phosphatase will aid in understanding the substrate specificity of the enzyme and will be important in the rational design of inhibitors, with potential in the treatment of bone diseases.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Forkhead-associated (FHA) domains are modular protein–protein interaction domains of ~130 amino acids present in numerous signalling proteins. FHA-domain-dependent protein interactions are regulated by phosphorylation of target proteins and FHA domains may be multifunctional phosphopeptide-recognition modules. FHA domains of the budding yeast cell-cycle checkpoint protein kinases Dun1p and Rad53p have been crystallized. Crystals of the Dun1-FHA domain exhibit the symmetry of the space group P6122 or P6522, with unit-cell parameters a = b = 127.3, c = 386.3 Å; diffraction data have been collected to 3.1 Å resolution on a synchrotron source. Crystals of the N-terminal FHA domain (FHA1) of Rad53p diffract to 4.0 Å resolution on a laboratory X-ray source and have Laue-group symmetry 4/mmm, with unit-cell parameters a = b = 61.7, c = 104.3 Å.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Energy Dispersive X-ray Diffraction System at Brock University has been used to measure the intensities of the diffraction lines of aluminum powder sample as a function of temperature. At first, intensity measurements at high temperature were not reproducible. After some modifications have been made, we were able to measure the intensities of the diffraction lines to 815K, with good accuracy and reproducibility. Therefore the changes of the Debye-Waller factor from room temperature up to 815K for aluminum were determined with precision. Our results are in good agreement with those previously published.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Using the energy dispersive x ...ray diffraction (EDXD) technique, the room temperature diffraction pattern of Al powder was obtained at diffraction angles ~ 30° and 50°. From the small angle diffraction pattern the average relative intensities (IR) of the (111), (200), and (220) lines were measured to be equal to 100, 62, and 32 respectively. From the large diffraction angle IR for the (220), (311+222), (400), (331+420), and (422) lines were measured to be 100,201,17,90, and 19.5 respectively. The diffraction pattern at those two angles were obtained at several higher temperatures to measure the change in the intensities of the Al lines. From the intensity changes the increase of the Debye- Waller temperature factor, i.e ~B(T), with respect to the value at room temperature was determined to be 0.6+0.1 at 250°C, 1.10+0.15 at 350°C, 1.45+0.20 at 450°C, and 2.20±0.35 at 550°C.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The temperature dependence of the crystalline structure and the lattice parameters of Pb1-xLaxZr0.40Ti0.60O3 ferroelectric ceramic system with 0.00 x 0.21 was determined. The samples with x 0.11 show a cubic-to-tetragonal phase transition at the maximum dielectric permittivity, Tmax. Above this amount and especially for the x = 0.12 sample, a spontaneous phase transition from a relaxor ferroelectric state (cubic phase) to a ferroelectric state (tetragonal phase) is observed upon cooling below the Tmax. Unlike what has been reported in other studies, the x = 0.13, 0.14, and 0.15 samples, which present a more pronounced relaxor behavior, also presents a spontaneous normal-to-relaxor transition, indicated by a cubic to tetragonal symmetry below the Tmax. The origin of this anomaly has been associated with an increase in the degree of tetragonality, confirmed by the measurements of the X-ray diffraction patterns. The differential thermal analysis (DSC) measurements also confirm the existence of these phase transitions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mastoparans are tetradecapeptides found to be the major component of vespid venoms. A mastoparan toxin isolated from the venom of Anterhynchium flavomarginatum micado has been crystallized and X-ray diffraction data collected to 2.7 Angstrom resolution using a synchrotron-radiation source. Crystals were determined to belong to the space group P6(2)22 (P6(4)22). This is the first mastoparan to be crystallized and will provide further insights into the conformational significance of mastoparan toxins with respect to their potency and activity in G-protein regulation.