Paternidade socioafetiva, adoção à brasileira e suas atuais implicações

O objetivo desta monografia é a análise do direito de família, mais especificamente do instituto da paternidade socioafeitva e seu reflexo em situações atuais como a adoção à brasileira. A metodologia deste trabalho foi baseada na revisão de pesquisas bibliográficas, doutrinárias, legislativas e jurisprudenciais. A análise discorre, primeiramente, acerca do conceito da paternidade socioafetiva e da maneira como que os vínculos sociais e afetivos têm sido avaliados como predominante em relação ao vínculo de consanguinidade, considerando o melhor interesse do menor. Posteriormente foi abordado o tema adoção, a “adoção à brasileira”, e como a mesma, tipificada como crime no Código Penal Brasileiro, pode ser solucionada pelo instituto da filiação socioafetiva. Por fim foram revisadas as apreciações de como os tribunais brasileiros adéquam o procedimento de adoção na nova realidade familiar brasileira, tendo em vista a falta de previsão legal, o que leva para os juízes a decisão acerca deste tema. Paralelamente são apresentados exemplos das decisões tomadas caracterizando jurisprudências no tema.

Genetic monogamy in the absence of paternity guards: the Capricorn silvereye, Zosterops lateralis chlorocephalus, on Heron Island

We investigated the genetic mating system of a socially monogamous passerine bird, the Capricorn silvereye Zosterops lateralis chlorocephalus, on an island of the Great Barrier Reef. There were no cases of extrapair paternity (EPP) among 122 offspring from 53 broods detectable by minisatellite or microsatellite DNA fingerprinting. Behavioral observations of paired birds showed that this was not a consequence of efficacious paternity guards and that females did not engage in extrapair copulation (EPC). Frequency of intrapair copulations was also low, with only 14 cases observed during 199 hours of observations of the 11 focal pairs in the fertile periods of females, and this was consistent with anatomical features of the cloacal protuberance in males. In this population, young birds form life-time pair bonds soon after gaining independence but females are obviously not attempting EPC possibly to redress this early mate choice. This is despite the fact that they breed in high density with a synchronous start and asynchronous spread of laying in a protracted season and males do not positively exhibit mate guarding behavior when females are fertile. Our results support high fidelity of socially monogamous birds on islands and are consistent with the hypothesis that sexual selection is reduced where genetic variation in fitness is limited.

Factors influencing paternity success in Antechinus agilis: last-male sperm precedence, timing of mating and genetic compatibility

We describe the patterns of paternity success from laboratory mating experiments conducted in Antechinus agilis, a small size dimorphic carnivorous marsupial (males are larger than females). A previous study found last-male sperm precedence in this species, but they were unable to sample complete Utters, and did not take male size and relatedness into account. We tested whether last-male sperm precedence regardless of male size still holds for complete litters. We explored the relationship between male mating order, male size, timing of mating and relatedness on paternity success. Females were mated with two males of different size with either the large or the small male first, with 1 day rest between the matings. Matings continued for 6 h. in these controlled conditions male size did not have a strong effect on paternity success, but mating order did. Males mating second sired 69.5% of the offspring. Within first mated males, males that mated closer to ovulation sired more offspring, To a lesser degree, variation appeared also to be caused by differences in genetic compatibility of the female and the male, where high levels of allele-sharing resulted in lower paternity success.

Extra-pair paternity and mate-guarding behaviour in the brown thornbill

We used multilocus DNA fingerprinting to assess parentage in the brown thornbill, Acanthiza pusilla, a socially monogamous Australian passerine. Extra-pair paternity was uncommon (6.2% of 178 offspring; 11.9% of 67 broods) and there was no evidence of intra-specific brood parasitism. Extra-pair paternity was limited because pairs spent more time together when females were fertile and males were able to evict intruding males before they could approach the female. Males were responsible for the close proximity of partners during the fertile period. Mate guarding therefore appears to be a male tactic aimed at preventing female infidelity rather than a cooperative behaviour of the pair aimed at preventing extra-pair copulations and/or female harassment. Females did not attempt to escape male guarding and were rarely observed to solicit copulations from intruding males. Nevertheless, females paired to smaller and younger males were more likely to cuckold their mates than females paired to larger and older males. This suggests that females may be more likely to seek or accept extra-pair matings when paired to small, young males or that old, large males are better at preventing their mates from engaging in extra-pair copulations. We found that male age but not male size influences mate-guarding behaviour. Older males tended to respond more aggressively to intruders. We therefore speculate that the relationship between male size/age and extra-pair paternity in brown thornbills may arise because female thornbills prefer large males as mates but are unable to express this preference as easily when paired to older males.

The paternity of the price-quality 'value map'

In the literature on firm strategy and product differentiation, consumer price-quality trade-offs are sometimes represented using consumer 'value maps'. These involve the geometric representation of indifferent price and quality combinations as points along curves that are concave to the 'quality' axis. In this paper, it is shown that the value map for price-quality tradeoffs may be derived from a Hicksian compensated demand curve for product quality. The paper provides the theoretical link between analytical methods employed in the existing literature on firm strategy and competitive advantage with the broader body of economic analysis.

Multiple paternity and its consequences in the white campion " Silene latifolia "

Summary Several studies have demonstrated that the number of pollen donors siring seeds of individual fruits is frequently greater than one and, consequently, that plants have multiple mates. Multiple paternity can have important consequences at the population level. It influences the genetic variability of a population, the reproductive success of males and the fitness of females and future generations. It also influences male-male interactions for fertilization and it is fundamental in providing opportunity of female choice. I investigated the occurrence and the importance of multiple paternity within fruits in natural populations of the dioecious Silene latifolia using microsatellite DNA markers, especially developed for this study. I found that multiple paternity occurs in all populations investigated in the European range of the species, varying from one to nine sires per fruit with a mean of three, suggesting that multiple paternity is highly prevalent in natural populations. In the presence of multiple paternity I investigated if there was a female genotype influence on siring success of the males. I used the same pollen mixture from two males and applied it to three replicate females of different relatedness (two full sisters and one unrelated). I found female genotype influence in one of the two populations investigated, which might reflect different population history. Since these results suggested some degree of female choice, we investigated whether the occurrence of multiple paternity and post-pollination selection could provide opportunity for inbreeding avoidance. First, I measured inbreeding depression at different life-cycle stages for offspring obtained by single-donor crosses with brothers or unrelated males replicated on distinct flowers on the same female plant. To address inbreeding avoidance, I determined paternity in crosses using mixed pollen loads of the two males. I found significant inbreeding depression in the studied population, even under benign experimental conditions, and although the unrelated male did not sire significantly more offspring, there was an effect of genetic dissimilarity on paternity. This suggests that paternity is affected by relatedness among mates, but maybe additionally affected by other factors such as pollen competitive ability or male-female interactions. Using inbred and outbred crosses, I further investigated sex ratio bias inheritance in this species, and found that sex ratio bias of the parental generation was significantly correlated to pollen germination success of the F2 generation, which suggests that sex ratio bias in this species results from the specific X/Y combination and not only on Y performance. An effect of X and Y is consistent with sex chromosome meiotic drive. In conclusion, I found multiple paternity to be widespread in the study species and that females of similar genotype produce similar paternity shares. I found that inbreeding depression is substantial, therefore receiving pollen from several donors might lead to fewer inbred offspring, I also found an effect of genetic dissimilarity on paternity shares, which indicates that there is some ability to discriminate against related pollen, although this seems not to be the only determinant of paternity outcome. Finally I found sex ratio bias to be dependent on both X and Y chromosomes as predicted by sex chromosome meiotic drive. Résumé Plusieurs études ont démontré qu'il n'était pas rare que les graines contenues dans un même fruit soient issues de la fécondation par plusieurs pollens provenant de mâles différents, ce qui sous-entend que les plantes peuvent avoir plusieurs partenaires sexuels. La paternité multiple peut avoir d'importantes conséquences au niveau populationnel dans la mesure où elle peut influencer le degré de variabilité génétique de la population, le succès reproducteur des mâles, la fitness des femelles et des futures générations. La paternité multiple peut également avoir un impact sur les interactions mâle-mâle lors de la fertilisation et peut être considérée comme fondamentale vis-à-vis de la femelle, qui y trouve alors une opportunité de choisir son ou ses partenaires. Dans le cadre de ce travail de thèse j'ai cherché à déterminer si la paternité multiple était un phénomène observable et important dans les populations naturelles de l'espèce dioïque, Silene latifolia. Pour ce faire, j'ai utilisé des marqueurs microsatellites, spécialement développés pour cette étude. J'ai observé des phénomènes de paternité multiple dans toutes les populations de l'étude, réparties dans l'aire de distribution européenne de l'espèce. Le nombre de pères par fruit varie de un à neuf, avec un nombre moyen de trois, ce qui signifie que la paternité multiple est très répandue dans les populations naturelles. En raison de ces résultats, je me suis demandée si le génotype de la femelle influence le succès de paternité des mâles. J'ai alors réalisé des pollinisations manuelles sur la base d'un mélange de pollens issus de deux mâles, que j'ai appliqué sur trois femelles (réplicats) présentant différents degrés d'apparentement (deux soeurs. et une femelle étrangère). Il ressort de cette expérience que le génotype de la femelle peut influencer la paternité dans l'une des deux populations étudiées, ce qui pourrait refléter des différences en terme d'histoire des populations. Dans la mesure où ces résultats suggèrent un certain degré de choix chez la femelle, j'ai cherché à savoir si la paternité multiple et la sélection post-pollinisation pouvaient être des moyens d'éviter les croisements consanguins. Dans un premier temps, j'ai évalué la dépression de consanguinité à différentes étapes du cycle de vie chez des descendants issus de croisements à un seul donneur, celui-ci étant alternativement un frère ou un étranger, répliqués sur plusieurs fleurs d'une même plante femelle. Afin d'estimer l'évitement de croisements consanguins, j'ai effectué des croisements dont le pollen était un mélange des deux mâles (frère et étranger), puis j'ai déterminé la paternité dans les fruits obtenus. J'ai pu mettre en évidence un effet de dépression de consanguinité- significatif dans les populations étudiées, même dans des conditions expérimentales moins rudes qu'à l'extérieur. Bien que le mâle étranger n'ait pas engendré un nombre significativement plus important de graines, il y avait un effet de dissimilarité génétique sur la paternité. Ceci suggère que la paternité est affectée par le degré d'apparentement entre les partenaires, mais qu'elle peut aussi être affectée par d'autres facteurs tels que la compétitivité du pollen ou encore par les interactions mâles-femelles. L'utilisation de croisements consanguins et hybrides m'a également permis d'étudier l'héritabilité du biais de sex ratio chez cette espèce. Il s'est avéré que le biais de sex ratio de la génération parentale était significativement corrélé au succès de germination du pollen de la génération F2, ce qui signifie que, chez cette espèce, le biais de sex ratio résulte d'une combinaison spécifique de X/Y et non uniquement de la performance de Y. Un effet de X et Y est compatible avec l'hypothèse de distorsion de ségrégation méiotique des chromosomes sexuels. En conclusion, il ressort de mes résultats que la paternité multiple est un phénomène largement répandu chez S. latifolia et la paternité accomplie par un mâle est plus similaire entre soeurs qu'avec une femelle étrangère J'ai également mis en évidence que la dépression de consanguinité a un impact considérable; aussi, recevoir du pollen de plusieurs donneurs différents pourrait permettre à la femelle de produire moins de descendants consanguins. J'ai aussi trouvé un effet de la dissimilarité génétique sur le partage de paternité, ce qui indique que la discrimination contre le pollen d'apparentés est possible, bien que cela ne semble pas être le seul facteur déterminant dans le résultat de la paternité. Enfin, j'ai trouvé que le biais de sex ratio est dépendant des deux chromosomes X et Y, conformément à la théorie de distorsion de ségrégation méiotique des chromosomes sexuels.

Paternity and health services. Qualitative research on men's experiences during pregnancy, delivery and postpartum of theirs partners

Background: Little research has been carried out with regards to the inclusion of men during the birth process. The objective of this paper involves exploring the needs and expectations of the health services manifested by a group of fathers as a result of their experience during the birth process. Methods: Qualitative research was carried out in Granada in 2004 via individual interviews with fathers who showed shared responsibility in the upbringing. The profile is: employment, medium-high educational level, one or more child: 0-6 months of age. The transcript was subsequently submitted to hermeneutic analysis. Results: Some semantic constructs are: 1) Health Services do not concede the women as protagonists, 2) Birth process is depending on the body. Fathers can only support and fight for the relevance of men, 3) Men seem like “invisible”, 4) Health services inhibit their participation, and 5) have dealings with fathers according to their gender roles. The participants address the relationship between expectations of care during the birth process and unsatisfied demands, and the manner in which they employ the obstacles encountered within health services that inhibit their participation as arguments that confirm their separation from the process. Conclusions: This paper draws attention to the limited scope of the provision of healthcare during the birth process in terms of protagonism afforded to fathers. Indeed, despite their requisitory discourse, the interviewees manifest contradictory attitudes in the face of changes that require them to make commitments. We identify elements that could be improved to adapt services to the needs of fathers and vice versa.

Male reproductive success and multiple paternity in wild, low-density populations of the adder (Vipera berus).

We studied for the first time the occurrence of multiple paternity, male reproductive success, and neonate survival in wild, low-density adder (Vipera berus) populations using 13 microsatellite loci. Paternity was assigned for 15 clutches, collected during 3 years. Our data demonstrated that multiple paternity can occur at a high level (69%) in natural populations of V. berus, even if the density of adults is low. The high proportion of multiple sired clutches was comparable to the proportion observed in captive populations. Male reproductive success significantly increased with body length, and only the largest males successfully sired entire clutches. Finally, no relationship was detected between the number of fathers per clutch and neonate survival. These results suggest that multiple matings could be beneficial in populations with high level of inbreeding or low male fecundity.

Fathers of girls, fathers of boys: influence of child's gender on fathers' experience of, engagement in, and representations of paternity.

The aim of this study was to examine the influence of child's gender on several dimensions-of paternity: the fathers' personal experience of paternity, their involvement in child rearing, and their representations. A total of 147 Swiss fathers of 18-month-old children (65 girls and 82 boys) relationship to the child or relationship with the child's completed questionnaires. The child's gender had little influence on paternal experience, mother. Globally, the fathers took on few responsibilities which were largely devolved to mothers. Fathers of boys were more involved in child care than fathers of girls. Finally, a discrepancy was found between the fathers representations of paternal roles in rearing girls and boys and the actual level of responsibility that fathers adopted in their relationship with their child.

Multiple Paternity in Polyandrous Barn Owls (Tyto alba).

In polyandrous species females produce successive clutches with several males. Female barn owls (Tyto alba) often desert their offspring and mate to produce a 2(nd) annual brood with a second male. We tested whether copulating during chick rearing at the 1(st) annual brood increases the male's likelihood to obtain paternity at the 2(nd) annual breeding attempt of his female mate in case she deserts their brood to produce a second brood with a different male. Using molecular paternity analyses we found that 2 out of 26 (8%) second annual broods of deserting females contained in total 6 extra-pair young out of 15 nestlings. These young were all sired by the male with whom the female had produced the 1(st) annual brood. In contrast, none of the 49 1(st) annual breeding attempts (219 offspring) and of the 20 2(nd) annual breeding attempts (93 offspring) of non-deserting females contained extra-pair young. We suggest that female desertion can select male counter-strategies to increase paternity and hence individual fitness. Alternatively, females may copulate with the 1(st) male to derive genetic benefits, since he is usually of higher quality than the 2(nd) male which is commonly a yearling individual.

Cross-amplification of polymorphic microsatellites reveals extra-pair paternity and brood parasitism in Sturnus vulgaris

We tested the cross-amplification of 37 microsatellites in a population of starlings (Stumus vulgaris). Twenty-three of them amplified and five exhibited a large number of alleles per locus and high heterozygosity (on average: 14.6 alleles/locus and H. = 0.704). We assessed the occurrence of extra-pair paternity (EPP) and intraspecific brood parasitism GBP) in this population. The EPP rate was 16% to 18% offspring from 43% to 45% of nests. IBP was very variable between two successive years (14% to 27% chicks from 25% to 64% of clutches). These five polymorphic markers will be of potential use in studies of genetic diversity, population structure and reproductive strategy of this species.

Extra-pair paternity, testes size and testosterone level in relation to colour polymorphism in the barn owl Tyto alba

In many bird populations, individuals display one of several genetically inherited colour morphs. Colour polymorphism can be maintained by several mechanisms one of which being frequency-dependent selection with colour morphs signalling alternative mating strategies. One morph may be dominant and territorial, and another one adopt a sneaky behaviour to gain access to fertile females. We tested this hypothesis in the barn owl Tyto alba in which coloration varies from reddish-brown to white. This trait is heritable and neither sensitive to the environment in which individuals live nor to body condition. In Switzerland, reddish-brown males were observed to feed their brood at a higher rate and to produce more offspring than white males. This observation lead us to hypothesize that white males may equalise fitness by investing more effort in extra-pair copulations. This hypothesis predicts that lighter Coloured males produce more extra-pair young, have larger testes and higher levels of circulating testosterone. However, our results are not consistent with these three predictions. First, paternity analyses of 54 broods with a total of 211 offspring revealed that only one young was not sired by the male that was feeding it. Second, testes size was not correlated with male plumage coloration suggesting that white males are not sexually more active. Finally, in nestlings at the time of feather growth testosterone level was not related to plumage coloration suggesting that this androgen is not required for the expression of this plumage trait. Our study therefore indicates that in the barn owl colour polymorphism plays no role in the probability of producing extra-pair young.

Male reproductive success: paternity contribution to queens and workers in Formica ants

The relative number of workers and female sexuals fathered by two males mated with a queen were directly assessed using microsatellite and allozyme markers in field colonies of the ants Formica exsecta and F. truncorum. In both species one of the two males consistently fathered more offspring than the other. There was, however, no evidence that one male might be particularly successful in fathering a disproportionally high proportion of female sexuals relative to the proportion of workers. Moreover, in F. exsecta, the proportions of worker pupae and worker adults fathered by each male did not differ significantly between cohorts. The most likely explanation for this pattern is that females store different amounts of sperm from the two males they mated with.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

The emergence of parental and paternity leaves in Switzerland : a challenge to gendered representations and practices of parenthood?

The thesis addresses the issue of parenthood and gender equality in Switzerland through the emergence of parental leave policies. This is an original and relevant research topic, as Switzerland is one of the few industrialized countries that have not yet implemented a parental or paternity leave. I first describe the emergence of parental leave policies in the last ten to fifteen years in the political, media, and labor-market spheres. Secondly, adopting a gender and discursive theoretical approach, I analyze whether and to what extent this emergence challenged gendered representations and practices of parenthood. The multilevel and mixed-methods research design implies analyzing various data sets such as parliamentary interventions (N=23J and newspaper articles (N=579) on parental leave policies. A case study of a public administration which implemented a one-month paid paternity leave draws on register data of leave recipients (N=95) and in-depth interviews with fathers and managers (n=30). Results show that parental leave policies, especially in recent years, have been increasingly problematized in the three social spheres considered, as a result of political and institutional events. While there is a struggle over the definition of the legitimate leave type to implement [parental or paternity leave) in the political sphere, paternity leave has precedence in the media and labor-market spheres. Overall, this emergence contributes to making fatherhood visible in the public sphere, challenging albeit in a limited way gendered representations and practices of parenthood. Along with representations of involved fatherhood and change in gender relations, different roles and responsibilities are attributed to mothers and fathers, the latter being often defined as secondary, temporary and optional parents. Finally, I identify a common trend, namely the increasing importance of the economic aspects of parental leave policies with the consequence of sidelining their gender-equality potential. The dissertation contributes to the literature which analyzes the interconnections between the macro-, the meso- and the micro-levels of society in the constitution of gender relations and parenthood. It also provides useful tools for the analysis of the politics of parental leave policies in Switzerland and their effects for gender equality. - Cette thèse traite de la parentalité et de l'égalité de genre en Suisse à travers l'émergence des congés parentaux. Ce sujet de recherche est original et pertinent puisque la Suisse est à ce jour un des seuls pays industrialisés à ne pas avoir adopté de droit au congé parental ou paternité. Cette recherche décrit l'émergence des congés parentaux au cours des 10 à 15 dernières années dans les sphères politique, médiatique et du marché de l'emploi en Suisse. En combinant perspective de genre et analyse de discours, elle examine dans quelle mesure cette émergence remet en question les représentations et pratiques genrées de parentalité. Des méthodes de recherche mixtes sont employées pour analyser des interventions parlementaires (N=23) et des articles de presse (N=579) sur les congés parentaux. L'étude de cas d une entreprise publique qui a adopté un congé paternité payé d'un mois s'appuie sur des données de registre (N=95) et des entretiens semi-structurés avec des pères et des cadres (n=30). Les résultats indiquent que dans les trois sphères considérées, les congés parentaux ont reçu une attention croissante au cours de ces dernières années, en lien avec des événements politiques et institutionnels. Alors que dans la sphère politique il n'y a pas de consensus quant au type de congé considéré comme légitime (congé parental ou paternité), dans les sphères médiatique et du marché de l'emploi le congé paternité semble l'emporter. Dans l'ensemble, l'émergence des congés parentaux contribue à rendre la paternité plus visible dans l'espace public, remettant en question-bien que d'une manière limitée-les représentations genrées de la parentalité. En effet, d'une part l'image de pères impliqués et de rapports de genre plus égalitaires au sein de la famille est diffusée. D'autre part, mères et pères continuent à être associés à des rôles différents, les pères étant définis comme des parents secondaires et temporaires. Finalement, l'analyse révèle une tendance générale, soit l'importance croissante accordée aux aspects économiques des congés parentaux, avec pour conséquence la mise à l'écart de leur potentiel pour l'égalité de genre. Cette thèse contribue à la recherche sur les liens entre les niveaux macro- meso- et microsociaux dans la constitution des rapports de genre et de la parentalité. Elle propose également des outils pour analyser les politiques de congés parentaux en Suisse et leurs implications pour l'égalité de genre.