1000 resultados para Obstacles detection


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A reliable perception of the real world is a key-feature for an autonomous vehicle and the Advanced Driver Assistance Systems (ADAS). Obstacles detection (OD) is one of the main components for the correct reconstruction of the dynamic world. Historical approaches based on stereo vision and other 3D perception technologies (e.g. LIDAR) have been adapted to the ADAS first and autonomous ground vehicles, after, providing excellent results. The obstacles detection is a very broad field and this domain counts a lot of works in the last years. In academic research, it has been clearly established the essential role of these systems to realize active safety systems for accident prevention, reflecting also the innovative systems introduced by industry. These systems need to accurately assess situational criticalities and simultaneously assess awareness of these criticalities by the driver; it requires that the obstacles detection algorithms must be reliable and accurate, providing: a real-time output, a stable and robust representation of the environment and an estimation independent from lighting and weather conditions. Initial systems relied on only one exteroceptive sensor (e.g. radar or laser for ACC and camera for LDW) in addition to proprioceptive sensors such as wheel speed and yaw rate sensors. But, current systems, such as ACC operating at the entire speed range or autonomous braking for collision avoidance, require the use of multiple sensors since individually they can not meet these requirements. It has led the community to move towards the use of a combination of them in order to exploit the benefits of each one. Pedestrians and vehicles detection are ones of the major thrusts in situational criticalities assessment, still remaining an active area of research. ADASs are the most prominent use case of pedestrians and vehicles detection. Vehicles should be equipped with sensing capabilities able to detect and act on objects in dangerous situations, where the driver would not be able to avoid a collision. A full ADAS or autonomous vehicle, with regard to pedestrians and vehicles, would not only include detection but also tracking, orientation, intent analysis, and collision prediction. The system detects obstacles using a probabilistic occupancy grid built from a multi-resolution disparity map. Obstacles classification is based on an AdaBoost SoftCascade trained on Aggregate Channel Features. A final stage of tracking and fusion guarantees stability and robustness to the result.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Dissertação apresentada na Faculdade de Ciências e Tecnologia da Universidade Nova de Lisboa para obtenção do grau de Mestre em Engenharia Electrotécnica e de Computadores

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Dissertação apresentada na Faculdade de Ciências e Tecnologia da Universidade Nova de Lisboa para a obtenção do grau de Mestre em Engenharia Electrotécnica e de Computadores

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This dissertation presents an approach aimed at three-dimensional perception’s obstacle detection on all-terrain robots. Given the huge amount of acquired information, the adversities such environments present to an autonomous system and the swiftness, thus required, from each of its navigation decisions, it becomes imperative that the 3-D perceptional system to be able to map obstacles and passageways in the most swift and detailed manner. In this document, a hybrid approach is presented bringing the best of several methods together, combining the lightness of lesser meticulous analyses with the detail brought by more thorough ones. Realizing the former, a terrain’s slope mapping system upon a low resolute volumetric representation of the surrounding occupancy. For the latter’s detailed evaluation, two novel metrics were conceived to discriminate the little depth discrepancies found in between range scanner’s beam distance measurements. The hybrid solution resulting from the conjunction of these two representations provides a reliable answer to traversability mapping and a robust discrimination of penetrable vegetation from that constituting real obstructions. Two distinct robotic platforms offered the possibility to test the hybrid approach on very different applications: a boat, under an European project, the ECHORD Riverwatch, and a terrestrial four-wheeled robot for a national project, the Introsys Robot.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Polymorphism, along with inheritance, is one of the most important features in object-oriented languages, but it is also one of the biggest obstacles to source code comprehension. Depending on the run-time type of the receiver of a message, any one of a number of possible methods may be invoked. Several algorithms for creating accurate call-graphs using static analysis already exist, however, they consume significant time and memory resources. We propose an approach that will combine static and dynamic analysis and yield the best possible precision with a minimal trade-off between used resources and accuracy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The purpose of this research is design considerations for environmental monitoring platforms for the detection of hazardous materials using System-on-a-Chip (SoC) design. Design considerations focus on improving key areas such as: (1) sampling methodology; (2) context awareness; and (3) sensor placement. These design considerations for environmental monitoring platforms using wireless sensor networks (WSN) is applied to the detection of methylmercury (MeHg) and environmental parameters affecting its formation (methylation) and deformation (demethylation). ^ The sampling methodology investigates a proof-of-concept for the monitoring of MeHg using three primary components: (1) chemical derivatization; (2) preconcentration using the purge-and-trap (P&T) method; and (3) sensing using Quartz Crystal Microbalance (QCM) sensors. This study focuses on the measurement of inorganic mercury (Hg) (e.g., Hg2+) and applies lessons learned to organic Hg (e.g., MeHg) detection. ^ Context awareness of a WSN and sampling strategies is enhanced by using spatial analysis techniques, namely geostatistical analysis (i.e., classical variography and ordinary point kriging), to help predict the phenomena of interest in unmonitored locations (i.e., locations without sensors). This aids in making more informed decisions on control of the WSN (e.g., communications strategy, power management, resource allocation, sampling rate and strategy, etc.). This methodology improves the precision of controllability by adding potentially significant information of unmonitored locations.^ There are two types of sensors that are investigated in this study for near-optimal placement in a WSN: (1) environmental (e.g., humidity, moisture, temperature, etc.) and (2) visual (e.g., camera) sensors. The near-optimal placement of environmental sensors is found utilizing a strategy which minimizes the variance of spatial analysis based on randomly chosen points representing the sensor locations. Spatial analysis is employed using geostatistical analysis and optimization occurs with Monte Carlo analysis. Visual sensor placement is accomplished for omnidirectional cameras operating in a WSN using an optimal placement metric (OPM) which is calculated for each grid point based on line-of-site (LOS) in a defined number of directions where known obstacles are taken into consideration. Optimal areas of camera placement are determined based on areas generating the largest OPMs. Statistical analysis is examined by using Monte Carlo analysis with varying number of obstacles and cameras in a defined space. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This thesis project aims to the development of an algorithm for the obstacle detection and the interaction between the safety areas of an Automated Guided Vehicles (AGV) and a Point Cloud derived map inside the context of a CAD software. The first part of the project focuses on the implementation of an algorithm for the clipping of general polygons, with which has been possible to: construct the safety areas polygon, derive the sweep of this areas along the navigation path performing a union and detect the intersections with line or polygon representing the obstacles. The second part is about the construction of a map in terms of geometric entities (lines and polygons) starting from a point cloud given by the 3D scan of the environment. The point cloud is processed using: filters, clustering algorithms and concave/convex hull derived algorithms in order to extract line and polygon entities representing obstacles. Finally, the last part aims to use the a priori knowledge of possible obstacle detections on a given segment, to predict the behavior of the AGV and use this prediction to optimize the choice of the vehicle's assigned velocity in that segment, minimizing the travel time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.